Transcript

arnt2-005

ID
ZDB-TSCRIPT-141209-1198
Name
arnt2-005
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000062216 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000062216|OTTDARG00000027333|ZDB-GENE-001207-3 arnt2|no_translation arnt2-005 LG_none 1 FO082028.10,CABZ01029565.1,BX936312.12 Danio rerio protein_coding KNOWN, 2080 bp
GTTAAACATTATTTGGGAAATATATGTAAAAAAAAAAATT
CAAAGGGCCCTAGACTTATAATAAAAGTAGTTTTACATTT
TTTAAACTCCATTTTAAGGACAAAAACTGAAACTGGAAAG
GATTAAATAAAAACACTGAATAATTTATTAACGTATTATA
GTACAAATAAAACCATAAAATTAAAATAAATTAGAAAAAA
ATGCTGTAATATTAATAAATTATTCCTGGGTAACTTGTTT
ATCATAATTTAAGTGCAAAACAATAAATAAAGCAAATACA
AATATGAAAATAAATAAGCATTTAAAAGGAAAAATAAAAT
AATTTAAAAGTATCCCGAGTTATTGTAGTTGATTACAAAT
AAAACCATAAAATATTATAAATTCATTCATTATAATTATT
AAAAAACTAATTTAAAAAGCAATACATTTAAAATGAAAAG
CAACAATACAAAAGAGAAGGAAATAAGTCACAATATTAAA
GTAAACTGATATAACATACAATATGTTGATACAATAGTTA
CAGTGAAACTAAATTTATCAATGAATTAATTTTTAGGTAG
TTGCTAAAATTAAACAAAACACAATTTCTCATGTTTGGTT
TATTTTTACTTTACATATGCTAAGATTAATTAAAGCAGAC
ATAGCAAATGTGTACAACACTGAGATACTGACACTTACTG
TAGTTTGTGTTTTTATTTATTTTCTTTTGTTCTTCATTAT
CACATTACCATATTCACACACACTATCTGTAAGTCAAGCC
ATACAACACAAGAAATATGCTTCATAATCACTTCATTTTA
GCCTCAATCATAAACTTCAGAGCTTCTACACCTGCTCACG
TTCCTTACATTGCTCTTTTTCTGTCCGACAGGTATGATGA
TGATCAGATTCCTGGTGATAAGGAGCGTTACGCCAGAGAG
AATCACAGCGAGATCGAGCGGCGCAGACGAAATAAAATGA
CGCAGTACATCACCGAGCTGTCGGACATGGTACCCACCTG
CAGCGCCCTGGCCAGAAAACCAGACAAACTCACCATCCTG
CGCATGGCCGTCTCTCACATGAAGTCCATGAGGGGAACCG
GAAACACCTCAACCGACGGCGCCTACAAACCCTCCTTCCT
CACTGAACAGGAGCTGAAGCACTTGATTCTGGAGGCGGCC
GATGGCTTCTTGTTCGTGGTTGCGGCTGAGACGGGACGGG
TGATCTACGTGTCTGATTCGGTGACTCCTGTCCTCAACCA
TCCGCAGTCAGAGTGGTTCGGTAGCACACTGTTCGAGCAG
GTCCATCCAGACGACGTTGACAAACTGAGGGAGCAGCTGA
GCACGTCTGAGAATTCAATGACAGGTCGTATTCTGGACCT
GAAGACGGGGACAGTGAAGAAGGAAGGTCAACAGTCCTCT
ATGAGGATGTGTATGGGCTCCAGGCGCTCCTTCATCTGCA
GAATGAGGTGTGGCAGTGCACCTTTGGATCACATCTCATT
GAATCGATTGTCCAGCATGAGAAAGAGATACAGGAATGGT
CTCGGTCCGTCTAAGGAGGGTGAAGCGCAGTACTCTGTTG
TTCATTGTACCGGCTACATCAAGGCCTGGCCGCCAGCGGG
CATGACTATTCCAGATGAAGACACAGAAGCAGGTCAAACT
AGCAAATACTGCTTGGTTGCTATTGGAAGACTGCAGGTGA
CCAGCTCTCCTGTTTCAATGGATATGAACGGACTTTCAGT
TCCGACTGAATTCCTTTCACGCCACAATTCGGATGGCATC
ATCACATTCGTGGACCCTCGATGCATCAACGTGATTGGCT
ACCAACCTCAGGATCTTCTTGGCAAAGACATTCTGGAGTT
CTGCCACCCGGAGGACCAGAGCCACCTTCGGGAGAGTTTC
CAGCAGGTACGCCAAAACCAGATTAAACCCGTCAGCCAAC
ACCAATCACATATTTCCCACATGATGTTTTTTTAACAGAT
CAAGGAATATTTCACAGTGTTTCCTATAATATATATTTTT
TCTTCTGGAGAAAGTCTTATTTGTTTTATTTCGTCCAGAA
TAAAAGCAGTTTTTAATAAAAAAAAAAAAAGAAAAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations