Transcript

zgc:56576-003

ID
ZDB-TSCRIPT-131113-687
Name
zgc:56576-003
Previous Names
  • ch211-266o15.2-003
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055310 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055310|OTTDARG00000038597|ZDB-GENE-040426-1082 zgc:56576|no_translation CH211-266O15.2-003 LG_ CR774184.20 Danio rerio protein_coding NOVEL, 794 bp
TTTCCGTTCTGCCAGTGCCATTTGAAGGCTGTTTTAGATT
GTGGCTTTTTAAACAAAATCGTGTATCTATTAACGCCATT
AAATAAGTTCGCAGTGGAAAAGGGATGTTTCGCAGAAAGC
TCACAGCCTTAGAATATCACAACCCGACTGGATTTGATTG
TAAAGATGAAACCGAGTTTAGAAATTTCATAGTTTGGCTG
GAAGATCAAAAAATCAGACACTACAAGATTGAAGACCGAG
GAAATCTCAGAAATATTCCCAGCTCAGACTGGCCTAAATA
TTTTGAAAAGTACCTTCAAGATGTGAACTGTCCATTCAGC
GTTCAGGAAAGACAGGAGACTGTTGACTGGCTGCTGGGCC
TTGCTGTTCGTTTTGAGTATGGAGACAATGTGGAGAAATA
TCGAAACTGCAAACCTGTGACGGAGACCAATGATGTGCAG
AAGTCTGCAGACCCGTTAATTAATCTGGACAGTAACAATC
CAGATTTTAAGGCTGGTGTCTTGGCTCTTGCAAATCTTCT
TAAAATTCAGCGACATGATGACTATTTGGTGATGCTTAAA
GCCATTAAGATCCTTGTACAGGAACGTCTAACCCCTGATG
CTATTGCAAAGGCCAGTCAAGCAAAAGAGGTAAACACAGT
GTTTTTTTCTAAAAGGAAACTATTTAGACTTCTTCAAAAA
TATTTATATCCTTGCTTGCTTACTCCCAGGACTGTTTATA
TCGAAGTTGATATTTAGCCGCACCATGGTAGTGTTTCGTA
ACATCTAATTGTTATGAGGTGGGTCGTTAGCTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations