Community Action Needed: Please respond to the NIH RFI
Transcript

rtraf-201

ID
ZDB-TSCRIPT-131113-2277
Name
rtraf-201
Previous Names
  • ch211-266o15.2-001
  • zgc:56576-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055308 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055308|OTTDARG00000038597|ZDB-GENE-040426-1082 zgc:56576|OTTDARP00000043383 CH211-266O15.2-001 LG_ CR774184.20 Danio rerio protein_coding NOVEL, 1161 bp
TTTCCGTTCTGCCAGTGCCATTTGAAGGCTGTTTTAGATT
GTGGCTTTTTAAACAAAATCGTGTATCTATTAACGCCATT
AAATAAGTTCGCAGTGGAAAAGGGATGTTTCGCAGAAAGC
TCACAGCCTTAGAATATCACAACCCGACTGGATTTGATTG
TAAAGATGAAACCGAGTTTAGAAATTTCATAGTTTGGCTG
GAAGATCAAAAAATCAGACACTACAAGATTGAAGACCGAG
GAAATCTCAGAAATATTCCCAGCTCAGACTGGCCTAAATA
TTTTGAAAAGTACCTTCAAGATGTGAACTGTCCATTCAGC
GTTCAGGAAAGACAGGAGACTGTTGACTGGCTGCTGGGCC
TTGCTGTTCGTTTTGAGTATGGAGACAATGTGGAGAAATA
TCGAAACTGCAAACCTGTGACGGAGACCAATGATGTGCAG
AAGTCTGCAGACCCGTTAATTAATCTGGACAGTAACAATC
CAGATTTTAAGGCTGGTGTCTTGGCTCTTGCAAATCTTCT
TAAAATTCAGCGACATGATGACTATTTGGTGATGCTTAAA
GCCATTAAGATCCTTGTACAGGAACGTCTAACCCCTGATG
CTATTGCAAAGGCCAGTCAAGCAAAAGAGGGTTTACCAGT
CACCCTTGATAAGCATATATTAGGATTTGACACCGGAGAC
GCTACTCTGAATGAAGCAGCCCAAATTCTTCGTTTGCTTC
ATATTGAGGAGCTCAGAGAGTTACAGACCAAGATTAATGA
AGCCATCGTCGCAGTTCAGGCCATCATCGCAGACCCCAAG
ACAGATCATCGCCTCGGAAAGGTTGGCAGATAAAAACATC
CGCCTGGACCTTGTAAAACAGATCCTCTCCATCAGACGTG
CTCTGTGAAATATGCTTGTTTTCAGTTACCAGACCGCAGA
TATTCTGTCGGAATTCAAGGCATTTTTGTGGGAATGCCAA
ACTGGACTATTTGTTTTCATTATTGCATATTTGCTTTGCC
CTGTCAAAAAAAAAAAAGCAAAAAGATTTATTGCAAAATT
TAATTTCATTGTAACTGTAAGCCTTATGTGGAGGCACTTA
AAATGCTACATCGGTTACCATATAAAAAACAGTTGGACTG
TATGTTTTTGTTGCACAATAAACCTTAATTCAACACAGAA
A

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations