Transcript

cr853299.1-201

ID
ZDB-TSCRIPT-131113-548
Name
cr853299.1-201
Previous Names
  • adcyap1r1b-001
  • dkey-46i24.4-001
  • si:dkey-46i24.4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000054740 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054740|OTTDARG00000038199|ZDB-GENE-110127-1 adcyap1r1b|OTTDARP00000042968 DKEY-46I24.4-001 LG_none CR848029.6,CR853299.8 Danio rerio protein_coding NOVEL, 2674 bp
TGCGCAGCGCATATCAGGGATCATTGTGAGTCTGCGCGGA
TAACCGCTCGGCAGCGGAGTGTTTCAACACAATATCGAGA
ATAGCGAGTTACATTCAGACATCCCTCACCTCAGACCTTG
CCGTTTCTCTCTGTGTATCTGCGCTTCTTTTTGATCCATT
GCCTTGATTAGACGTCTATAAGTGAGGTAACTGTTCCCTC
ATTTATCTCAGAGCCAGAGAGGCGTACACACACACAAGTT
GTCCGCAGAAGTTTTTCGGGGCGTCTTGCGGGAATGTTTG
TGCAGCAGCGCGCGCCGCAGCACTTCCACCGCCTGTGACT
GACAGCGCGAGACAATCTGCATTCTGCATCGGGTTCAAAC
GTCCTTTCCAGAGACCTCCAGCCGTCTGGGACAATCCGAT
AAGAATCCGAAGAACTGCAGCAGTTTTCCAGTGTACCTGT
TTACCATCCTGCAGTTTGTTGTTCCTCTCTGCTGCTGCTC
ATCGGTGGATATAATCGCTTCAGTGCTCCAGACAAAATGG
CTTCCACAGTGAGAAAATGTCAGCACCTGTTTTTAGCACT
CATCCTTCTTCCTATGATCTACTGCATGCATCCAGACTGT
GTCATTCAGTTAGAGAAGGAGAAGTGTATTGAAAGGATGT
TCCTGGATGATCCCAACAGTGAACCGGAATTAGTCTGTCG
ATGGATGTGGGACAACCTTACCTGCTGGCAGCCTGCAAGA
CTGGGTCAAGTTGTCTGGATGCCCTGTCCTGAACTATTTG
AAGTCATGAATGATGAAAATAACGAGTTTGGAAAGGTGAG
TCGTAACTGCACTGAATATGGCTGGTCGGAGATGGTCCCA
CACTACGTTGATGTTTGCCCTTTCAATGAAAATGGAACAA
ATCCAGATATGTACTATGTGTCAGTAAAGGCTCTGTATAC
TGTGGGCTACAGCACCTCTCTGGTATCTCTCACCACTGCC
ATGGTCATCCTCTGCAAGTTCAGGAAGCTACACTGCACCC
GGAATTTCATTCATATGAACCTGTTTGTGTCCTTCATCCT
GAGGGCCATCTCGGTTTTCATTAAAGATGGCATTTTATAT
GCAGAGGAGGACAGCAACCATTGCTTTATACACACTGTGG
AGTGTAAAGCGGTGATGGTATTTTTTCACTATTGTGTTCT
GTCAAATTACTTCTGGCTGTTCATCGAGGGCTTGTATCTC
TTTACTTTGCTCGTTGAGACGTTCTTTCCAGAGAAAAGAT
ACTTCTACTGGTATACCATTATTGGATGGGGTACTCCAAC
AATATGTGTGACTATCTGGGCTGTTTTAAGAGCTCATTTT
GATAACATTGGTTGCTGGGATATTAATGACAATGCTACCA
TCTGGTGGGTGATAAAGGGCCCTGTTCTTGCCTCTATTAT
GATCAACTTTATACTGTTCATTGGCATCATTATAATCTTG
GTGCAGAAGCTGCAGTCTCCAGACATCGGAGGGAACGAGT
CCAGCATTTATCTGCGTCTGGCTCGCTCCACTCTGCTCCT
CATTCCCCTGTTTGGCATCCACTACACTGTCTTTGCTTTT
ACTCCAGAAGATGTTAGTAAGAGAGAAAGGCTGGTGTTTG
AGCTCGGTCTTGGGTCTTTTCAGGGTTTTGTTGTAGCTGT
CCTTTACTGCTTCCTTAATGGAGAGGTGCAGTCCGAAATC
AAGCGAAAGTGGCGCAGCTGGACGGTGAACCGCTACTTTG
CGGTGGACATGAAGCACAGACACCCTTCTCTGGCCAGCAG
TGGAGTCAACGGGGGAACACAGCTCTCCATCCTCAGCAAA
AGCAGCTCGCAAATCCGCATGTCCAGCCTTCAAGCCGAAA
CACCGGCTACGTGAGCGCTCAGACCCACAAACTGAAGGCC
AAACACCTCAGAGCGACATCCCATAATCTACAGTGCGTCA
ACAACATACAAATCCTGTTTCATCTTCGTTTGAGGTCCGT
ATCGTGTCGGTTAAAGTTGTAATATCTGGCAACCGTCAGC
TGTATTATCTGGCAATCGCCAATAGATGGCAGGATTTCGC
TGTGAGAAATCAGAGGAGGTCGCAAACGGTGTTGTATTTT
GATATGAACCGAAAGGAATTACTTACGAAGGAAACAAAAA
TTCCGAATCTGTAACTGTGAGGTGTTTAGGATGCAGTTTT
TGTACATATAAAAAAGTCTGTCACGTTTTCTTTTTTTCTG
TATGTGAAGAATTGTGAAGATTTCGCATTAGTTCGTTGTC
ATACAGAAGCGGTTGGTCTGAATGAAGACAGCATCAAGTG
GAAAGAGTCATTTTTGAAAGGAGAAGAAATAACATTTTTG
GCCCACAGGAGCTTAATGAACTGATTTCCTGTTCCTAAGA
TGAATTTAATATTGAATGAATGTTAATGTTAATGTTAAAT
GTTATGAATGTAAATAGTTTATTATGTTGTAAATGTATAT
TGAAGAGAATGCAGAGAAAGGACAATGAAGATGTTTAGTA
AATGTTGAAGTCCTGGGACTTAGGCCTACAGTATTTCCCG
AACTGGCATTTGAAACCTCTTTAAAAGAATAACTTTTTTT
TACTGAGTGAATTCCTCTTCTATTTCTTTTGGTTACATAT
TATATTTTTAAATAGCCGTTGGTACAGAAAATGTCAATTA
GAATATAACAAAGCAGTAAACACGTGCCACATAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations