Transcript

adcyap1r1b-002

ID
ZDB-TSCRIPT-131113-2128
Name
adcyap1r1b-002
Previous Names
  • dkey-46i24.4-002
  • si:dkey-46i24.4-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000054741 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054741|OTTDARG00000038199|ZDB-GENE-110127-1 adcyap1r1b|no_translation DKEY-46I24.4-002 LG_none CR848029.6,CR853299.8 Danio rerio protein_coding NOVEL, 535 bp
GTGAGCTGAAAGCTTATATATTTTTTTGGCTTTTGTTTTT
CTATGCAGATATTATTCAGCTATTAAACAATATTACAATA
GATGCTGCTTTTTTTACCGTTTTGAAAACCATTTTCATTT
ATCTTTTCAGGGTTTTGTTGTAGCTGTCCTTTACTGCTTC
CTTAATGGAGAGGTGCAGTCCGAAATCAAGCGAAAGTGGC
GCAGCTGGACGGTGAACCGCTACTTTGCGGTGGACATGAA
GCACAGACACCCTTCTCTGGCCAGCAGTGGAGTCAACGGG
GGAACACAGCTCTCCATCCTCAGCAAAAGCAGCTCGCAAA
TCCGCATGTCCAGCCTTCAAGCCGAAACACCGGCTACGTG
AGCGCTCAGACCCACAAACTGAAGGCCAAACACCTCAGAG
CGACATCCCATAATCTACAGTGCGTCAACAACATACAAAT
CCTGTTTCATCTTCGTTTGAGGTCCGTATCGTGTCGGTTA
AAGTTGTAATATCTGGCAACCGTCAGCTGTATTATCTGGC
AATCGCCAATAGATG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations