ZFIN ID: ZDB-TSCRIPT-131113-4774
Transcript Name: gar1-201
Previous Name: gar1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000060048 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000060048|OTTDARG00000041650|ZDB-GENE-040426-893 gar1|OTTDARP00000046473 gar1-001 LG_ CU467639.6 Danio rerio protein_coding KNOWN, 2348 bp
ATTTACGGCAGGCTGTGCACTGCAGGCAGGCACGTGTGGT
TCAGAGTCAACAGCGTGTTGATCATTCATATTCCAACCAC
ACAACTTTAAAGGATCTCCGTCATGTCTTTCCGTGGTGGC
GGCGGTGGTCGAGGAGGAGGTTTTAACAGAGGTGGTGGTG
GTGGTCGTGGAGGCGGATTTGGAGGTGGTCGTGGAGGTGG
ATTTGGAGGTGGTCGTGGAGGCGGATTTGGTGGGGGTCGA
GGAGGCAGAGGTGGATTTAACAGGAACCAAGACTATGGCC
CACCTGAATATGTTGTCGCACTGGGGGAGTTCATGCACCC
CTGTGAGGATGAGATTGTCTGTAAATGTGTGACGGAAGAG
AACAAAGTCCCATACTTCAATGCTCCTGTATATCTGGAGA
ACAAAGAACAGATTGGAAAGGTGGACGAGATCTTTGGGCA
GCTCCGTGATTTTTATTTTTCAGTCAAACTTTCTGATAAT
ATGAAGGCATCCTCATTCAAAAAGTTACAGAAGTTCTACA
TTGACCCCATGAAGCTGCTTCCCCTGCAGAGATTCCTGCC
CAGGCCTCCGGGTGAGAAAGGGCCTCCTCGTGGAGGGAGA
GGAGGAGGAGGCAGAGGTGGGAGAGGAGGCGGCTTCCGTG
GAGGTCGTGGTGCCAACGGTGGAGGTCGTGGAGGATTTGG
TGGACGCGGAGGAGGATTTGGTGGACGTGGAGGTGGCGGT
GGAGGATTCAGAGGAGGCAGAGGTGGAGGCGGTGGACGTG
GATTCAGAGGTGGAAGATGATGAATGTCTCGCAGGATGGG
ATCTGTCCTTTCATTGGCTGATAAGACCTCCATTGTGAAG
TCAGAAGCAGCAGCGTTTGGGGCCAACCAAAGTCTTTAGA
CTGCTAATTGACTCCTCTCTTGTACAGCTGAACTTTTTAC
TTCATTTTGTACCATATTTGTATTTTCTCAGCAGTGGACT
TCTTGTTTTATTTGGTATACTGATAGGGCTAATGTTTTAG
GCTAATGTTCGCATGTCTGTGTACGAGAGGACGGGTGTCT
CCACAACCTTGGCTGGTTGGTTTGCATCAACTTATGTTTT
TACAATTACTTGATGTTGGACAAGTAGTAACTTGAACAGC
ACCAGGATTATGATATGTGAAGCCATCTTCACAGATTACA
GTGTAATAACATTTAATTTTTGGTTTATGATGGATGTCTA
CATTTAAAAAAGATTGCCATTGTGTTTCAGTTGAACTCCA
GCTGCCACCATGGACTTAATAAATTCTGTGGTTTATTTAC
AACACTTTGGTTCGGTTTTTACTAATTCTGTCTTGATATT
TGTTCTGAGCAAAGCTAAAGAGATTAGGTTTTGAAATCTT
CTTAATAAGAGAGATTTATTGTTTCTGCAAAATTAACAGG
GACTGTTTCTTTCTGAACAGCAGTGTGTGTGTTATCAGCA
GCTGGACGAAGTGTTTAATCATGGATTTTCCAGATCTTTC
AGTGTACAACCAGACAGGATTGGGAAATTCTCTTGAATTT
TTCTTGTGGAAACAGCCATGGAATTCAGTTAAAAATAACA
TTTTATACAATTTTGAAGATCCTCCTAATAGATTAAAGAG
GGTTGTTTGAACTACTGTAAGAATTTTGACCATTTCAGGC
ATTACAGAATCACATTTTGGTGGCTATTTATTTGTGGTCA
TTAATACACTTGCCCACTGCATCTGTAGTTATTCAAGCTT
TTGATAAAAGGGAATGGCCGCTTGTAGTTTGTTGAAATGT
CCTAATAATTATAATGTGATTGTTACTTTTTCCCCACAAG
AAAATGCATTTTAATGGTTTAGCATAAATGTAATTGCCTG
AAAATGTTTACCAATAACTATAAAGCAATCTATGTAGATG
ATGATGGTTATAGATCTTAATTTAAATGTATCTAAAAAAG
ACTTGTCTTCTAACACTGATGCTTTTATTTAGCATTTGAC
TTTCACCCCAAAAAACAGTCTGACCCCACTATTAAACTCA
CTCTCGTATTCAAAGAGTTTTATTGGCATGACTGAAACCA
AGCACAATGATGCCAAAGCAGTAACAATAAATAAAATACA
AAACATATACAAGAATTTAAGTAATAATGAACACGCATGC
ATATATCGTTATATATGCATATCTGTTGTCATAATAAACA
AGTTATTTAAGTATTTAAAAAAATCCCTCTCTCAATGCAA
TAATTGCTTTATTGGCATGATACTGGCAAATATTAAATAC
AACATAAATAATATATTATTATTCAATGTGTCACATGTTA
GTCGTTCATTTTTTGACATTGACATTTTTTTATTGATTCA
TACAAATGAATAAAATAGATCAGAGTAC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gar1-201 Contained in:
[BAC] CH73-36J8 (1)

Genome Resources: Vega_Trans:OTTDART00000060048 (1),  Ensembl_Trans:ENSDART00000111189 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC045900 (1) 1284 bp
GenBank:EH495404 (1) 1008 bp
CITATIONS (2)