Transcript

dchs1a-201

ID
ZDB-TSCRIPT-131113-4428
Name
dchs1a-201
Previous Names
  • dchs1a-001
  • ch73-307f18.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057617 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057617|OTTDARG00000040155|ZDB-GENE-120410-3 dchs1a|OTTDARP00000045140 CH73-307F18.1-001 LG_none CR388091.9,CU633884.1,CU656046.7 Danio rerio protein_coding NOVEL, 12286 bp
CTGAGGTTGAGCGCGTGTGCTGGAAGTGTGGATTCTAGAG
TTGATGCTGTTGTCGATGCTGACGGACTGATTTCATCCCG
TCTGCTGCGCTCAGTTCTGGAGCACCGAGCCCTTCTTAAT
TGATGCAGTGTATTTTGAGCTTGACAACAAACGGAAAGAG
ACAGAAAACTGGAAATACATTAGTGGAAGTTGTTGTGGCA
CACGATAACAAGTTTAACTTGTAAGAAGATGGATATAATC
TAACACGGATACTTCTGAAACGACTTTTCTGTGTTTTCCC
CTGACATTACGCTTGCACAACTGACTGGATCTCCATCACT
GAAAAGCACGAACAGATGAGTGTTTTGTGAGAAGAAATTT
CAATGAAGAGTAAAGGAAGGACGATAATGGATCCATTGCG
TCAAATCAGGACTTTGAAGTGGTGGATACTGGTAATCCTT
TATGTGGTGCCACAACTAATAACCATCCATTCATCCATGG
TGCCAGGAACATTGCAGCTTCAACTAGATGAAGAACAGCC
AGCAGGAACTGTTGTAGGAGATATCAGTGCTGGTCTCCCA
CCTGACATGACTGCATCCCACTATTTCATCTCAGATCATC
AAGGTACAGGTGTCAGCACCGATCTGGACATTGACGAGAG
TACGGGGATCATCAAAACAGCAAGGGTCTTGGATCGGGAA
GTGCGGGACCGTTACAGCTTCATAGCAGTCACCATGACCG
GTATAACAGTAGAAGTCACAATCTTAGTCAATGACATCAA
CGACCATGCACCAGTGTTCCCTAGGAAAAGAGCCACATTT
AAGATCCCAGAGCAGACAACCATCGGCACCAAGTTTCCTC
TTGAACCTGCAGTGGATGCGGATGAGGATCAGCTCACTAC
ACAAGGTTACATCATAACAGATGGAAATGTAGGACAAGCT
TTTCTTCTTGAAACCAAACGAGGGTCTAACAAAGTCCTCT
ACTTGGATTTGGTGGTCAATGCAGTTTTAGACAGAGAGAC
AAGATCTTCATACACTCTACTCTTGGAAGCGTTTGATGGC
GGTTCACCCAAGAGGACGGGACAGATGATCTTGGATGTGA
TTGTGCAGGACATCAATGACAACGCCCCAGTCTTCAACCA
GAGTCGCTACCATGCCATGATCTCAGAGAATCTTCAACCG
GGGAACAATATACTGCAGGTGTTTGCTTCAGATGCCGATG
AAGGTGACAATGGGTTGGTGCTTTATGACATCAACAGGAG
ACAGAGCGATCCTGATCACTACTTTGTTATTGACTCTCGA
ACAGGAGTTATCACTCTCAACAAGCCTTTGGATTATGAGA
TGAGAAGAGTTCATGAGCTTGTTGTACAGGCTCGTGACAA
TGCCAGTCAACCAGAGGTGACCAACTCTTTCGTGACCATC
CAGGTGAGAGACTACAATGACAACCAGCCCACCATGACCA
TCATCTTCCTTAGCGAGGATGGTTCTCCACGCATCTCGGA
AGGAGCACAGCCAGGCCAGTATGTGGCTAGGATTTCAGTC
ACAGACCCTGACTATGGAGAATACGCCAATGTGAACGTTT
CTTTGGAGGGGGGCAATGGAAAGTTTGCTTTGACCACCAA
AGACAGCATCATCTATCTCATCTGCGTAGATCAGATCCTT
GACCGTGAGGAGCAGGACCACTATGAACTCAGAGTCATGG
CCACAGATTCTGGGACCCCTCCGTTACGGGCAGAATCTTC
CTTTACAATTCAGGTCATAGATGTTAATGACAACCCACCT
TTGTTTGACCAGCAGGAATACACCCAGGTTATTCCAGAGG
TGGCCTTTCCAGGAAGTTTTGTAGTACAGGTTACAGCACG
GGACAAAGATCAGGGACCCAATGGAGATGTTCAGTACAGC
ATCTTGCAGAATGAAGGAACTCATTCAGATTGGTTCAGTG
TTGATGCAGTCACTGGTGTCGTTACTACCCTGACCCAGCT
TGATTATGAAATAGACCCTACGCCGAGTATAACTGTGGTT
GCCTCTGACAGAGGTCGACCGCCACTGTCTTCTACAGCTG
TTGTCAAAGTGATCCTTCAGGATATTAATGATAATGAACC
TGTGTTTGGCAGCAAGTTCTACAACGCATCCATTAAGGAG
AATGCTCCTGCAAGGACCTGTTTCATGGAGGTTACAGCTA
CTGATGCGGATGGTGGGTCTTTTGGCTCCATCTCTTACTC
TCTGGGCTCTGGTCAAGGCAGCGTGACCCCGTCTCAGTTC
ACCGTTGACAAGCACAACGGACAGATCTGTACTACCACCA
GTCTGGATCGTGACCAGGGTCCGGCCAACTACGACTTCAC
CGTCACAGCTGTGGATGGGGGTGGATTAAGTTCAGTGGCC
TATGTACGGGTGGACCTGATAGATATAAATGATAATCAAC
CTGCATTCTACCCTGTGAGCTATGCAGTAAGCCTGAGTAC
ACAGAGTGCTCCAGGGACATCCGTCCTGAAGGTGACTGCC
CATGACCCCGATGCGGCAGAGAATGGCAGAGTGACCTACC
GAACTGTTCCTGAAGGGAGCTCACCTTTCTTCACCCTCAA
CAAAGACACTGGAGTGATTTCACTGTCACGCGCTCTACAT
GGAAAGGCAAACTCAGTCATTACCATGGTGGTCTCAGCCC
AAGATGGTGGGGGTCTTACCGCTCCAGTCAATGCCAGGGT
CAACATCAGTATAGTGGCGGGACTGGTCGCACCCCCTGTA
TTTGAGCAAGCTCAGTACTACTTTGTGGTCTCAGAGGATG
CCCTGCGTGGAACACAAGTTGGTGTTGTGCGGGCCAGCAC
TAAGAATGGTGTCTTGAAGGATATCTCCTACATTATTAGC
TCTGGTGACCCAACAGGGTATTTTACTGTGGATTCAGAGA
CTGGGGCTTTGAGAACCAGCTTGCCTCTGGATCATGAGGC
CCAGCCAAGCTTGAATCTGGAAGTCCAAGCACACTGTGGA
AACCCACCAGCCTTTGGCCAGACTAGGGTACGAATTACGG
TGTCTGATGTCAATGACAATGCACCCGTCTTCCTGCCTTC
ATCCTCTGAATCATTGATTCTACCTGAAGACACACGGATG
GGTACAGTGGTTTACAAGGTCCAAGCAGAAGATCGTGATT
CTGGACCCAATGGCCTTCTGAGTTTTGACCTGTTCACCAG
CAGCGCCCATAGAACCTTCAGTATTGATCGCAACAGCGGA
CATTTACGCCTAATTGGCAGTTTGTCATATGAGACCATGC
CCCGTTATGACCTGCAGGTGATTGCTAAAGACAGTGGAGC
ACCCCAGCTAAGTTCTACATTTACTCTGGTCATCCACGTA
CAAGCTGAAAATGGACAAGGCCCTGTGTTTGATAGCCTCA
CATACAGAGTAGAGCTAAAGGAAAGCACCCCACTTAACAC
ACGCTTTCTACAGGTCCGAGCTGTGAACCGAGATGGTGGC
ATCACCACTGGACTGTCATCTACTTCTGCCTCACTAGCCT
ACCACCTGCACCCAGATGGTGATGCTGCAGGGTTTGGCAT
TGTGTCAGACAGTGGCTGGCTGTTCGTGAAAAGTGCCTTG
GACAGGGAAGCTAAGGAGATGTACCTGCTCACTGTATTGG
CCACATCAGGCAACGGACAGTTGAAGAAGACAGGTAGTGC
CACGGTGCGTGTGTCAGTGATGGATGAAAATGACAACACT
CCACGGTTTACCCAAGAGAGAGCTTTCCTGGCAGTGCGCG
AGAACCTGCCAGCAGGCACTGGTTTTGGCCGAGTGTCTGC
CAGCGATCGAGATGCTGGTCTCAACGGTCGGCTGAGCTAC
CGCCTGCTCCATCTGGATCGCCACTTCCAGATCAACTCCC
ACACAGGTGAGATAAGCACAAAACTTTCCCTTGACCGTGA
GCTTCAGTCCAGCTACCAGCTCATTGTGGTGGCTCAGGAT
GGCGGGACCCCTCCACGCAGCGCTACAGGCACTGCTTTCA
TCACGGTTCTGGATGAGAACGATAATGCACCCTCTTTCAG
CAATGCTCAGACTGGACGAGAGCTCTTGCTGCAGGCTTTG
GAAGGTCAGCCATCTGGATTTCTCCTGGGAACCGTTCATG
CAAAAGACCCTGATGAAGGAGAAAATGGAACTATTTTCTA
CTCCATGTCTGGTCCCAGAGCCGAACGTTTCACTCTAAAC
CCAAACACTGGAGAGCTACGCTCCTCGTCAGCTTTGAGCC
ATTCTGAACGGCCTGAGTACAGTTTCATCATTCTGGCTTC
TGACCGAGGCTCACCTCCTCAGAGCTCCATCATAGCACTG
AAAATACAGGTTCTGAGTTCAAGTAAAGGATCACCCAACA
CTAACTCCCAACCGCTAATATTAAAGTCTGTGGAGGGAGC
TAAACCTGGCTCTATGATAGGATCTGTGCGTTCACCTGAT
TCTCAAGCCCTTCCTGAGTCAGGCCAGGTCACTTTTACAG
TGGTTGGAGGCACGGACTTCGATGGCACTTTTGTGGTAGA
CCGACAAACAGGTGACATTTACCTGGCCCGTGAACTCGAC
TTCGAAAAATGTCCTCGATACACTCTACAAGTGGAGGTGG
ACGACTTCTCCATGCCGCTTCCCAAAAGTGACATCATTAC
ATTGATAATCGATGTCCAAGACAGCAATGACCATTCGCCA
GAGTTTCCTGAAGACCCCATTATCATAGTTGTCCCTGAAA
ACACAGATCCCGGTTCTTCTTTCTACACCTTCCAGGCCGT
GGATAAAGATGGAAGTGGACCCAACAGTGAAGTACATTAC
TCAATACTACAACAGTGGCCCAATATCCCAGATCTCCTGA
GTTTGGACCCAACCACTGGAGCTCTGTCTTTGGGGATGAT
GTTGGATCATGAGAAGACCTCTTCGCTGCTTTTGGTGGTC
CAAGCAAGTGATTCGGCCTTGGATGTCAGTCAGCGGCGGC
GTGGAAGCGTCACGGCTCGTATATTTGTCACTGATGTGAA
TGATAATGAGCCTGTGTTCATCTCAGCGTCTGTGGTGAGT
GTGATGGAGGATCAGCCTGTGGGTTTTGTGGTGGTTTACG
TCATGGCAGTGGATGCAGATCAGGGAGAGAACGGACGAGT
GACGTATCGCATCCAGAGCGGCAACGTTAGAGGAAAGTTC
AGCATTAACCCGGACACAGGCTCTTTGTCTATTCTTAGAC
CAATTGACCGTGAAGAAGAAGACCTCTACAACCTGACCAT
AGTGGCAGAAGACCACGGTTTACAGCAACGCAGCAGCTCA
CAGCTACTGTCAGTCCAGGTGATTGATGTAAATGATGAAG
CACCATACTTCCAGGAGAGCCAATATGAAGCTTTTATTGC
TGAGAATCAGCCTGCAGGATCCACCGTGCTGGTGGTTTCA
GCTTCTGATATGGACCAAGGGACCAATGGAATCGTGACAT
ATGGAAGCATTGTGGGAGATGATTTCAGTATTCATCCGGT
GACAGGAGTCATAACTACCACCAAAGCTTTGGATAGGGAG
GCCCAAGGCGTTTATGCTTTGACAGTTTATGCCAGAGATG
GTGGTTCTCCACCTAATTTCGCCAAAACCACAGTGCGGGT
CACTGTGCTGGATGAGAATGACAATAGGCCGGCGTTTGGG
AGAGTTTACTACAGTCTGGAGGTGCCGGAGAACCAGGAGC
CTGTGACGCTTTTCACCATTAGAGCCACAGATCAAGACTC
TGGAGACAGCGGGCTGGTGTACTACAGAATCACAGATGGA
GACCACTTTGGTGATTTCCACCTGGACAAGAAGTTAGGTG
TATTGTCTACTTCCAGAGCTTTGGACCGAGAATCTAGAGC
AAAGTACACCCTCACCGTTGAGGCACAAGATCAGGGTATA
CCATCCCTCACCAGCACCGTTACTTTGGACATCAGTGTCC
TGGACCTGAATGACAACAGCCCAGTGTTCCCCAGCAGCAG
CTACTCTGTGGAGGTATCAGAGGATGCTTCAGCAGGATCT
CTTGTTTTGGAGGTTTCAGCCTCTGACAAGGATGAAGGGT
CCAATAGCCAGGTGGTCTACTTCTTGAGTCGTGAATCCAG
TGGCATGTTCATTGTGGACCAACACACAGGTCGCATCATT
ACAGCGGCAACTCTTGATCGTGAAAAAGTGGCCTCCTACA
ACTTCCAAGTCTACGCCATGGACTCTTCAGCAACTAATCC
TCGTAACTCCTCCGCTGAAGTTGCCGTCCACATTTTAGAT
GTAAACGACAATGCCCCCTTTTTCATTACAGACCCGCTTA
TCATCAATGTCTCCATCAGTAGTCTCTCCAACCACAGAGT
GCTGGCAACTATGAGAGCAGAAGATAAGGACTTTGGTGCA
AATGGGTCTGTGTTCTATCGATTTGCCAATCCTGTCAAAG
GCTTCACCATAAACTCCCTGACGGGAGCCATCCAGGCCAC
AGAGAAGCTCCAAGCACTGACCCAGAGTCAGAGGATCCTC
ATTGTGGAGGCCATGGATCAGGGCAACCCATCGCAGTCCT
CTCTGGGCGTAGTAATTGTGTACATCAGAGAGCAGAGTTA
CCAGGGCGTCCGCTTCTCGCGCAACACTAGAGATGTGAGC
CTGCAGGAAAATGCAGCCAAAGGTACTGCAGTTGTTCAGA
TTCATGCTCAATATCCTGATGGTTCTACCAGTGGCATCAA
CTACAGCATATTCAGCGGGAACAAGCAGCAGTCATTTAGC
ATCAGCCATCATACTGGTGAGATTTGGGTAGAAGACTCCA
CAGGTCTGGACTTTGAAGAGACTCCACGACTCCGCCTGGT
GGTCAAGGCTGAAACAGCATCATCCAGCTCCTTCATGGCT
GTCAACCTTCTATTACAGGATGTCAATGACAACCTTCCAC
GCTTTCAGCTTCACAATTATGTCGCTTATGTTCGCGAGGC
CCAGGGCTATGATCATCCTATCATTCAGGTGTTGGCGAAT
GACCTGGACCAGGGTCAGAATGGGCAGGTGACCTACTCCA
TAAGGTCATCCTCCATGAGCGGCCTTTTCAAGATTGACCC
TATCACAGGAAGTATATCCACCGCTGCCATCATGGATAGG
GAGATCTGGACACAAACCAACCTGGTCATTATGGCAACAG
ACAGAGGCAGTCCTCGGTTGGCAGGATCTGCCACTCTCAC
TGTGATCATTGTAGACCTGAATGACAACAGTCCCACCATT
CCTGTTCCACGTGAAGTCCGGGTCCCTGAGAATACCTTGA
TTGGAACCATGATCACTCAGGTCACCGGGAATGATGTGGA
CTCAGGGCCTGCTCTCTCCTATACCCTTCTTCTGGACTCA
GACACTCAAGGGAAGTTTGGAATACACCGTTATGGAGGAG
GGGTGTCCCTTACTACCCCTCTGGACTTTGAGATTAAAAC
ATGGTACACACTGACAGTCAGCTCTTCAGACTCCAAGCAG
CAGAGTCATGCAAATCTGACCATACTTGTGGAGGACGTGA
ACGATAATGCTCCAGTCTTCTCCCAGGACCTGTATGAGGT
GACTCTAGCCGAACACTCGCCAGCAGGAAGCTCAGTTATC
ACAGTAACCGCTACAGATAAGGACTCTGGAGAGAACGGAA
GAATAACATACAGGGTCGTGTCAACAAAGGACATGTTCTA
CATTGACCCAAGCAATGGTACTCTGTTCATCAAGAAGGAA
GTTGAGTTTGACTCACAGCGGCCATCAATTTTGGTGGTGA
TCGAAGCCAGTGATAGTGGAACACCTCCGTTGACCGCCCT
TTCCACAGTTCAGGTGCATGTGTCCGATGTCAATGACAAT
GCCCCTGTATTCCACCAAACTGAATATAGAGCCTCTGTAT
CTGAAGACGAAGTTCCTGGTTCAACCATACTAACTCTGGA
AGCGGCAGATGGAGACTTATCAAGAGACAACTGCGGCTTT
GATTTTGCCATTGCCAGTGGAAACATTGGGAACACGTTTC
AAATTGAGAGCAGCGTTCGCTTCCTTGAAGGCCATGGATT
TCAGACAGTTGGGATGTTGATACTGGCTGATAAGCTTGAC
TTTGAAATTGCGAGTAGCTACAATCTCACTATTGTGGTCT
CAGATCGTGGTATACCACAGCGAAGCTCAAGTGTTCCTGT
TTTAATCAATGTAATGGACACCAATGATAACCCACCATCC
TTCAGTAGGGCAGAGTACAGCGCTGTTGTCAATGAAGGGG
CAGAAAGGGGAACGGAAATACTGCAACTTTTTGCTATCGA
CCCTGACTCAACACCTAATGGAGAGGTTCAATATTCAATC
AGTTCTGGAGATGATTCTGAGCTCTTTACTGTAGATCAGT
GGACTGGGGCTGTTCGTCTGCGGAGGTCCCTCGATAGTGA
GAAACAGTCCTCTCACATGTTTGTCATTCAAGCCTCGGAT
GGTCAGGGTCACTTTGCTCTTGCTCCAGTAACTGTCGAGA
TAAAGGACATCAACAATAACCGACCTTACTTTCCTCTTAA
ATCACTTACAGCAAGCATTCGTGAAAACCAGCCCCAGAAT
GCTCTAGTTACCATACTGCATGCCATTGATCATGACAAAG
GAGCATATGGAGAACTGAGATATTTCCTTACTTATAATGC
AGGCAATGGTAAAGATTCCTTCCTAGTGAACCAAACCTCT
GGTGAGGTGCGAACCCGCTTTACTTTCGATTACGAGAAGA
CAAACACTTTCAATTTTATTGCAATTGCAATGGATACGGG
CAACTATACGGCTACTGTCACTGTTCAAGTGTTTGTAACT
GGTGAAGATGAGTACGACCCCGTTTTCACTGAATCCGATT
TTGCCTTCCATGTCCCTGAGGGTGCAAAGAAGGGGCAAAG
CATTGGCCAAGTAAATGCCAATGATGAGGATGGAGGAGTG
GACGGCATTGTCCTCTACACCCTTGCAAACAGTTCACCTT
ACTTTGAGCTCAACACATCTACCGGTGTGATATCCCTCAA
GATGGATGCATATCATCGACATGTCACCCGGTCCAAAAGA
GAAACACGACAGATGACGTTGGATGTTATTGCCCATAGTC
CTTTAGAGAATTCCAGAAAAACTTCAGCCCAGATCACAGT
TGATGTCACACATACATCCTTTGGCTTGACCACAGACATG
AATGTAGTCCTTGCCAGTGCTATAACAGCTTCTTTGGCCG
CCATTGTGTTCCTGATCATAGTTGTCGTGGTGATATTCCT
CTTGAGATCCCAAAGGTATAAAGAACAAGAAACCTGCACC
CGAATAGTCACCCATGGTACCGTTCTGGAGAGTCTTGAAG
ATTCAAAAGTTCCTGGGGGTGATAAACTGTATCATCAGAC
CCTTCCGGGTTATGCAGCAGACCAGAGTGGAAATGTAGGA
GGTGCCTACACACGAGGAGGGTCTCTTGACCCATCCCACT
CAAGTGGACGAGGGTCTGCCGAAGCGGAGGCAGCAGAAGA
TGATGAGATCCGTATGATAAATGAGTATCCACAAGTTGCT
AGCATCTCCTCATCTATGCAGGAGCACATAGCTGCTCGAG
GGCCCGACTCTGGTATCCAGCAAGATGCAGACCAGCTGTC
TGACATTTCCTGTGAGCCGGGGATGGATGCAAACCAATGG
TTTAAAGGAAAGAAACTGGGAAGTTTAAGTGGGACTCTAT
TAGCAAGCCAGTTGCCAACTTATCGGGATGAAGGAGGTGG
ATATCTCGGGGTTGGCAGAGGGCTTAACATCTCACATCCA
AAAGATTATGCCTTTCCAGAGGATGGCAAGCCTGCTGTTG
ATGGTTCTCTTACTGCAATTGTAGCTAGCGATGAGGAACT
GAGAGGCAGCTACAACTGGGATTACCTCCTAGACTGGTGC
CCTCAATTTCAGCCCCTGGCTAATGTCTTCACAGAAATTG
CCAGATTAAAAGATGAAAATGCACCACCTAACCCTCGGCG
GCCATTTCATCCCAAAGCAAAGACTGATCCCAAGCCCAGG
ATTGATCCTCCTCCCCTTATTACTTCTGTAGCTCATCCTG
GGGCCAAAACTGTTTTGCCTAAACCTGCTGTAGGGCGAAC
ATTTCCCCACTTATCATCATTGCGACGATCTCCTATTGAC
CATGATGTTTCCTCGATTGCCATGTCCCCTAGTTTTTCTC
CATCGCTTTCACCACTTGCAGCCCATTCCCCAGCCATTGC
TCCTTTTGGAGGTCACTCGTCCTCCATAATCAGTACAACC
GAGCACGAGGAGACAGAACTGAGGATTTAATGAAGATCCT
TATCAGAAAGCATTCCCGCCTGACTCAGGTACTCTAAAAA
TGCCTCTCCTCTGGCATGGTCATCGTGTTGTATGTAATGT
TGCCCCACTGGCTGGCCAGAGGTTTCACAAAGCGGTGCTT
CTGTCACCCTTCTTACTGACTTGAGGTGGAAAAGAAGTAA
ACTATTTTATAATGCTGTTCTAATGTCCTGAAGAGCAGCT
GACATTGTTATTAGCCCAGTGTTTGCACATTTAAAAACAC
GGTTGTGTTCGATGTTGATGTTTTGTAAGAGAAAACACTT
TTGTATTATATATTTTTTTACTGATGTTTTTTTTTTTTTT
TAAATGAAATGACATATGTCAAATGGTTGCTATAACCGGT
GATTTTATTGACATACATTTATATTTGTATATATGTGGCC
GTAAGAGTATGTTTGTTATCAGAGCTTGTTTTGGTTTATT
AACAGTTGCCATTTTAACGTGCAAAGTAAGTTCAGTATTA
AGCTCTTAAATGTTTGGGGAATATATTTTGTTGTCAGTAT
TTATAAAAGACCGTTACAATATCTGCAAAATTGAAGGTTA
TGCTGCTTCCCCTCCCATAGCTTGACTAATGAGAACACAA
TTAAAGCTTGAATCACTAAAAATAGGAATCCATTAATTAA
ACAATGTTGTTCCCCATTTTGTAAGGATTTGAAAATCTTG
CAACAAGTTGCTCATTATTTAGTACATTGAAAAACCTTTT
TAGGTGCTGAAGCTCAAGCGATATATGTCAGGACTTTCAA
AACCTGAAAGGAAATAACAATAACAGAAATGCAAAACATT
GCTGACACCTACAAACACCACAACATAACTGGAAATAACA
GTACTGTCCTATTTAAGTGTTTATTTTTGTGTTTATTTCG
TATGGCCAGTGAAAATGGTTAGCATAAATAGGCTATTTCA
TAACATCAGATTTATTGGCTTTGGATATAATGACCACAAC
CATGTTCACACAGTCCAAACTGGATGTTTATGTTTAAATA
AATCAAGCTATCCGATTACATACTTCATTTGACTAAAAGA
TAGATGTACTCACAGCTCTACTAGTCGAGGTACTGAAGTG
TATAGGTACATATTTGTAGCATATTTCAAATATTACTGTG
GGTAAAAACAGTTGATAAGTTTATCTAATTATGCCACAAC
ATGCTGGATTACTTTTTACTTTCTTGTTTTTTGTTAATTA
CATTCCTAAATGAAGTTATGACACCCATATTTGTTTTAAA
AAAAAGCACTGGTTGGATTTTCATGGCATTTCTTCCTACA
ATGTACAGTTAAAAGAGCAAGTTAAAATATTTTAAACTAA
ATAATGGCGGGGTTGGACTTTCTCCAATAGCAGGACTCAT
TTTTGTAGCCTTTAAATTTGCTTAAGTGCTTGTGAAAAGT
ATTTTTTTGTACATACAGTACTTTCTAATGACTGTAAATG
TTGCTGTTTGACCATACTTCATTTTAGTTTAGTGCTGAAA
AAATAAATATTTCCTTCAATTTTAAAAACGTTGAGTCAGT
TTTGGTCAGCATACTGTCCTTCGTTTTCCTGTCGATTGAA
AGGCTCAACTTATAATTTGGAAAATCCACAGTGCCTATTA
AAGAAAGACCATTCAAATGATGCTTTGTTGATATTCTCAA
GGTCACAGGAACATTTCAGTATTCTAAGTTAAAGTTATTG
GTCTTTGTTTTGTTTTTGTGCTAGCCTGATTTAACAGAAT
ATTTCTCTTCTTGTTTAAAAGTCCTATATTTATGGCAGAT
ACTTCACTTTTGTACAGAAACAATTCCTCACTCGTAACTG
TGAACGTGTTATATTCATGCTGCCTTGAAGGAAAATAAAT
AATGTTCTGTTCATTTAAAAAAAAAGTTTCTCATAATGTT
CAAGTCACTGTTCATATTGTTATTGGTGAATGATGTCTGT
TTACATAACGTTTGAATAGCACTGTGGTCCACATTTGGCC
AGCTGTTTTCTTGCATTTGTACCAAGTATAACCCAAAGGG
CATTGAGTAGGTGGTTGTTCAGTGTCCACCGTAAACTTTT
CCTTTTTTGACAAAGTGCCTAATTAAAAATGTGTTTTTAA
TAATGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations