header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-4380
Transcript Name: tmem97-002
Previous Name: ch211-167j9.3-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000057383 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000057383|OTTDARG00000040004|ZDB-GENE-110627-1 tmem97|no_translation CH211-167J9.3-002 LG_ CR848814.7 Danio rerio protein_coding NOVEL, 542 bp
TTAAAATGTTTCTTCGCGTCCTGGAAATCATATACTTCAT
TTACTTCGCCTCGCACATTCCAATTACCCTCCTGGTTGAT
CTTCAAGCTTTACTTCCCGAACATGTATATCCACCTGAGC
TGATCAAGCTCCTGCACTGGTATGCTGGTGAATTTAAGGA
CCCGATGATGATGGACCCTCCTGCGTGGTTCAAGTCGTTT
GTGTTCTGCGAGGCGCTCGTGCAGCTGCCCTTTTTCCCAG
TTGCAGCGTACGCCTTTCTGAAGGGTCAGTTCTGCTCCGG
TCAAACCATCACTCCTGTTATAATTTGTAGAAGCGATTTT
TAATGTCACAACAGTGACATCTAACGGGCATAAGGCTTCA
TAACTAAACCAGAGTTGTATTTAAAACGACTTTTAAGCAA
TTTATCTACAGGGATTTCTGGAATTTTCAAAGGACTGATG
TTATTCCAGACATTGAAATTCGGGAAATATTATATTGTTG
TTGCCTGAGCCATGGATATCAGGGTTTTTATTGTCATATT
AAATGTTTTTTTTTTATCAAAA

tmem97 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA tmem97-201 (1)    Ensembl 1189
ncRNA tmem97-002 542
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tmem97-002 Contained in:

Genome Resources: Vega_Trans:OTTDART00000057383 (1),  Ensembl_Trans:ENSDART00000157271 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CR928518 (1) 539 bp
GenBank:AL927510 (1) 535 bp
CITATIONS (2)