header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-2787
Transcript Name: tmem97-201
Previous Names: tmem97-001, ch211-167j9.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000057382 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000057382|OTTDARG00000040004|ZDB-GENE-110627-1 tmem97|OTTDARP00000044972 CH211-167J9.3-001 LG_ CR848814.7 Danio rerio protein_coding NOVEL, 1189 bp
GGTCAGTTATCGAATCTAAAAAAGAGGATGTAGAAGTATC
ATCTGATTGACGGGTATAAAACAATTTATAAAAATTATGA
CAATATGCCATTGATATATCTATGAGTTGCTGCTATGGTA
GTTTTACGATTGCCCCATGAGCCAATGAGCAGTTGGGAAT
CCGCCCACTCCAGGAATCAACCGAGCCGATTGACCAATTG
GAAAACAAGGATTAAAAAGATCCGAGCCAAAGGACGAATC
AGGAACAGAGGATTAACACGCTACTCTACTCTTCCCACTG
ACGCCAATCCACCGCTGCTAAACCACCCTGACGGAGGAAC
AACCTGTCGAAAACACTTAACCCGTCACTTAAACCAGACA
ATTAAAATGTTTCTTCGCGTCCTGGAAATCATATACTTCA
TTTACTTCGCCTCGCACATTCCAATTACCCTCCTGGTTGA
TCTTCAAGCTTTACTTCCCGAACATGTATATCCACCTGAG
CTGATCAAGCTCCTGCACTGGTATGCTGGTGAATTTAAGG
ACCCGATGATGATGGACCCTCCTGCGTGGTTCAAGTCGTT
TGTGTTCTGCGAGGCGCTCGTGCAGCTGCCCTTTTTCCCA
GTTGCAGCGTACGCCTTTCTGAAGGGTGGCTGCAAATGGA
TCAGAACTCCAGCCATAATTTATTCTGTTCATGTGGCCAC
CACTCTGGTCCCAATTTTAAGCCACATACTTTTCCACAAG
TTTCCTTTGAGTCCACATCCGGGACCCCAAACTTTGAATG
AACGTCTGACCCTGGTGTCCATTTATGCTCCGTACCTCAT
CATTCCCATTATGATACTGCTCACCATGCTCTTCAGCGCA
ACTTACAACTCACCATCTCTGAAAGGAAATGCTCCCTCAA
AGGCCAAGAAACAAAGATAAATGCCAGTTCATCTTTCTAC
ACCCTAAATTAGAGCACAGTATGTATTGATCAAATCCCAA
CAGGGTTGTTAGTAGTCATTATTTGATAAACGTGATTTAA
TATGTGCCAAATTTCTCAATTATATGTGACCATTTTTTAA
GCTCTAGAAATTGTTTACCGATGACAGCAGATGTAAATGC
AAAATATATTTTTATTCAAATGTTCTTCAGATCTTTATGA
GCTTTGCCCAATGTTGAGATTACACATGGTAAATGTAAAC
AAGTAATAAATGAACTTACTTTTCCATAA

tmem97 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA tmem97-201 1189
ncRNA tmem97-002 (1)    Ensembl 542
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tmem97-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000057382 (1),  Ensembl_Trans:ENSDART00000122891 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EH439955 (1) 941 bp
GenBank:BC151870 (1) 932 bp
GenBank:EH538507 (1) 920 bp
GenBank:EH559728 (1) 849 bp
GenBank:EH515788 (1) 840 bp
CITATIONS (2)