Transcript

zgc:171901-202

ID
ZDB-TSCRIPT-131113-4266
Name
zgc:171901-202
Previous Names
  • ch211-210b2.5-002
  • zgc:171901-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056900 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056900|OTTDARG00000039664|ZDB-GENE-080220-13 zgc:171901|OTTDARP00000044637 CH211-210B2.5-002 LG_ BX248582.4 Danio rerio protein_coding PUTATIVE, 810 bp
GATTTTAGACAGGGGACTTTTATGTCGTTTCGTCGGTGAC
GTCATCAGTCAGCTCCGCGCTCCTGTTTGTTCTGAACAGG
CTCGACCAAGGGGCCTCCACTGGCTGCCTGTCCAATTCAG
AATTGATCTTCAGTGCTTTCACTGGTATATAAATCCCTTC
ATAATCCAGTCCCAACCCATCTTTCGGAGCTGTTGCACTT
TCAGATCAAGTGATTAAATCTTCTTGTAGCTCCTCAGTCC
AGACTGAAACACAGATGGGACAGAGCTTTCTCTGTGAGAA
CAGAACAGCAGATTATTATAAAGATGGCGTTTATTAAAGA
GGAGAGTGAAGATGTGGAGATTGAAGAAACATTCACAGTC
AAACATGAAGAGACTGAAGAAGCTTTCAGAGTCAAACATG
AAGATCCTGAGGAACAAACAGACCTGATGCTTCTGAAAGA
GGAAAATCAGGACCTGAAAGATGTGCAAGAGGAGGATCAG
CCTGAAGAACAACTTAATCTCAAAACTCGGACAACAAATA
AGTCTTACTTGCAAAAAAGTGTCCCGGAGACTAATTCCAG
TACCTGCCAGCAGTGTGGAAAGAGTTTCAGTGGGAAGCGA
AACCTTGAGGTGCACATGAGGATTCACACTGGAGAGAAGC
CGTTCACCTGCCAACACTGTGGGAAGAGCTTCACTCAAAA
GGGGAACCTTAAAAGCCACATGATAATCCACAGCGGAGAG
AAGCCTTACGCCTGCCAAATCTGTGGGAAGAAGTTTGCTC
AAAAACGAAACCGCGCCGACCACATGAGACTGCACACCGG
AGAGAAGTCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations