Transcript

zgc:171901-201

ID
ZDB-TSCRIPT-131113-2670
Name
zgc:171901-201
Previous Names
  • ch211-210b2.5-001
  • zgc:171901-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056899 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056899|OTTDARG00000039664|ZDB-GENE-080220-13 zgc:171901|OTTDARP00000044636 CH211-210B2.5-001 LG_ BX248582.4 Danio rerio protein_coding PUTATIVE, 2016 bp
GATTTTAGACAGGGGACTTTTATGTCGTTTCGTCGGTGAC
GTCATCAGTCAGCTCCGCGCTCCTGTTTGTTCTGAACAGG
CTCGACCAAGAGAACAGAACAGCAGATTATTATAAAGATG
GCGTTTATTAAAGAGGAGAGTGAAGATGTGGAGATTGAAG
AAACATTCACAGTCAAACATGAAGAGACTGAAGAAGCTTT
CAGAGTCAAACATGAAGATCCTGAGGAACAAACAGACCTG
ATGCTTCTGAAAGAGGAAAATCAGGACCTGAAAGATGTGC
AAGAGGAGGATCAGCCTGAAGAACAACTTAATCTCAAAAC
TCGGACAACAAATAAGTCTTACTTGCAAAAAAGTGTCCCG
GAGACTAATTCCAGTACCTGCCAGCAGTGTGGAAAGAGTT
TCAGTGGGAAGCGAAACCTTGAGGTGCACATGAGGATTCA
CACTGGAGAGAAGCCGTTCACCTGCCAACACTGTGGGAAG
AGCTTCACTCAAAAGGGGAACCTTAAAAGCCACATGATAA
TCCACAGCGGAGAGAAGCCTTACGCCTGCCAAATCTGTGG
GAAGAAGTTTGCTCAAAAACGAAACCGCGCCGACCACATG
AGACTGCACACCGGAGAGAAGTCCTTCACCTGCAACCTGT
GTGGAAAGAGCTTCACTCAGAAAGGCAATCTTAAAAGCCA
CTTGATCATTCACAGCGGAGAGAAGCCTTACAGCTGCCAA
CAGTGCCAAAGCACCTTCACTCAAAAGGTGCACCTTGAAC
AACACATGAAAGTCCACAGCGGAGAGAAGCCGTTCACATG
CGATCAGTGTGGAAAGAGCTTCACGCTCAAAGACTCTCTC
GGCTCCCACATGAGAGCTCACACAGGAGAAAGCCAGTTTA
TCTGTCATCAGTGCGGGAAAAGCTTCAATCACAAAAAAAG
CTTCAATATTCACCTGAGAGTTCACACCGGAGAGGAGCCG
TACACGTGCTGTTGGTGTGGACGGAGTTTCAGATATAAAG
CATCCCTCGATGTCCACATTAGAGTTCACACAGGGGAAAA
CCCTCATACCTGCCGACTCTGCGGGAAGAGCTTCACACAG
AAGGGCTCTCTTAAGGCACACATGATCATTCACACTGGAG
AGAAGCCGTTCACATGTGTTCAGTGCGGAAAGAGCTTTAG
ACGAAAACTAACCTTGAACGAACACGTGAAGATTCACATT
GAGAGTGAACTATTAGATCAATGTAATGCAGCTACATCAA
CGTGTAAAGATTCACTAACATGAAACACTTGAAGATACTA
AAGTAACTGGAGAGATGTTTGCCAGCACTACCTGCAAGAT
TAGCGCTTCCTTGATTGCTGCAGTCTTGAAGATTTGTGCC
CCAACCCTACCTAAACACACTTGAACAAGCTAATCAAGGA
CTTAGTGTTAAACTGTGGCAACACGGCACCTCATCAGTGT
GTAAAGATTCACCTACAAGAAACACTTGAAGACACTGTGA
AGTACCTGAAAACATGTTTGCCAGCACTACCTGCAAGCTG
AGCGCTTCCTGGATCGTTGCAGTTCTGAAGATTTGTGCCT
CAACCCTATTTAAACACACTTGAACGAGCTAATCAAGGTC
CATCGAGGTGTCAAACTGCACTTTTCGGCTCATTGACTTT
AATTCATAAGCATGCCAATTGCAGCAGACCAAAAACGCAA
GTTCTGACAACAAGTTTTTGATGTCAGTGTATTCGAAAGT
TCAAGCTTGGTGAACTCTGACCTGCAACATCACATCACGT
GATTGTGTGAGACCGATAGAAGAGCAAAGCTTGACCTCTC
TGTACAGAAAATTGAAATATGGAGCAGTTGCTCGATTTAT
TAATGTCGGATAATCTTTAATCCTGCCCTTTTTCGCAGCG
CATTATTCAGTGTGTCTGTCCACGTTTTGCACTTGTTTAA
ATTCTATTTAATGTAGCACACATAATTGCCGTCTTTTTGT
GGCTATCGTGACCTGACGCTTGACACTGTGAACATCAGTA
AAGATCGTCAATTGTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations