Transcript

hdac7b-002

ID
ZDB-TSCRIPT-131113-3802
Name
hdac7b-002
Previous Names
  • ch211-4c18.2-002
  • si:ch211-4c18.2-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055071 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055071|OTTDARG00000038439|ZDB-GENE-131127-113 hdac7b|no_translation CH211-4C18.2-002 LG_ CR847949.13 Danio rerio protein_coding NOVEL, 596 bp
AACGGTAGTCATGCCAATTGCTCATGAGTTTTCCCCAAAT
GTGGTCCTGGTTTCAGCTGGTTTTGATGCTGCCGAGGGGC
ATCCAGCTGCTCTGGGAGGATACAGAGTCTCCCCTAAATG
TTTTGGATGGCTGACGCAGAAGTTAATGGAGCTTGCTGAA
GGACGAGTAGTGCTGGTGTTAGAGGGAGGTTATGAGCTTG
TCTCCCTTTGCGATGCGTCCCAAGCTTGTGTCAGTGCTCT
TCTAGGAAATGAGCCTGAGCCTTTATCTGAGGTGGAGTTA
CTGAGAAGTCCCTGTGCTAATGCAGTCTGTTCTCTGGAGA
AAGTGCTGCATGTTCAGAGTTTGCACTGGCGTTCAGTGCG
GTCCATGCTGAATACTGTGTCTCTGTCCTATGTTAAAGCA
GAGAGGAGAGTCTCGGCAGGCAGTGAAGCTGCTTTAGTGC
TGAGTGGCCTCAATATGACTGTTCCACACAGAAGACAGTA
AGACTACAGTATAAAGTAAAATAGTCGAGTTCTGAAAGTA
CAAATAACATTTATTTTCTCCCCAGAGAAACTTCAATGTA
ACTTATTGAATCTTTAATAACACGCTTTTGTTGAGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations