Transcript

hdac7b-201

ID
ZDB-TSCRIPT-131113-2206
Name
hdac7b-201
Previous Names
  • ch211-4c18.2-001
  • hdac7b-001
  • si:ch211-4c18.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055070 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055070|OTTDARG00000038439|ZDB-GENE-131127-113 hdac7b|OTTDARP00000043190 CH211-4C18.2-001 LG_ CR847949.13 Danio rerio protein_coding NOVEL, 3093 bp
AAGCGAACAACTGTTGATGTAGTGAGAAGAGAGGAAGCTG
AGCAGGAGGGGCTTCAGTCAGTAAATGTAGCTGTACTGTA
TGTCACTCAGCTAAATCACACCTTTGGAGTTTACAGCAGT
GGAGCGCCAGTGTTTCTGCAGATGCTTGCATTTCAGATTT
CTGCTGTTCATTTTATAGTGTGGACTCTAAAGTGAGCAAA
TGCATTTTAGTTGGTTTTGAGGACTTGATGCCCGGAAGTA
CATATTAGAAGTGGAAAAGATATGCAGACGTGACAGATGT
CTCACCATCAGCAGCACCGGACACTGGAGAGAGGGAGGAG
GAGCACACAAGAGGACAAACTGTCTTTGAGGAAAGAGAGC
GAACAAACAGGTGCTGGCTGTAGTCTCTCGGTGAGAAGAA
AGCTGTATGAGTATATCTGCAATAAGCAGCACAGGACATC
TGCAGGTCAGGACATACAGCAGCGTGAATTAGACCGACAG
GAAGAGGACAATCCACTAAGAAGAACAGCCTCTGAGCCTA
TTCTGAAGCTGCGATCAAAGAGAAGTATGACGGGGAGACA
GAATCCATTGCAGCGTAAAACCAGCGCGCCCCCTGCTGTC
GGGGATCCAGACTCCATGGCGGTTTCTGCCAGTTCTGCTA
CAGTTTCATCACTAGATAATCAAATGAATCGTCAAGAGCT
GATTCAAACCACAACCTACAGTGCATCATCAGGCAAGGAA
GACTCTCCTTTACAAATCAGCATTCAGCACCCCGTCCTCT
GGCCTGCATATGCTGCCACTGCTTACAATCCTCAGGTCTT
CACTCTTTATCCACATATTTTTACAGTTACTGGGCAGCAG
TGGCCGCCGATGCCTCATAGACCTTTAATCAAATCCCAGT
CAGCACCTTCTTATATACAGCAATACACACATATACACAC
TCCGGCTTATACACTGGTACAACCCATGTACCAACAACAG
TGGCCACAAGAGACATTCCAGCAACACACCCTTCCAGAAA
AGGTTTCAGTTGGCCCAGCATGGCCTGAGTCTCCTGGAGA
TCTGGGAAGGTTCAGAAAGAGAACAAGTGAGGAAGTACGC
ATTTCATCTCAATCCCCGCTTGAAAGCTGTAATCGACAGG
GAGTTCAGCTGAAAGAAAACTTGGAATGGAGACACAAAAT
ATTTCACCAGCAGGTTTCACGTGTGCATTCCTTTCCAGAC
ACCTTTGACACACGTCTGTCTTCACATTCAGCCTCAGCTC
TGGACATGAGAAAACCAAACTTCACCACAGGCTTGGTGTA
TGAGATGATGAAGCATAGGTGTGACTGTAGAGACAGCAGC
TGTGGTCTTCATGAAGCTGACCGAGTTACAAGTATCTGGT
CAAGACTGCAGGAGTGTGGCCTGAGGAGTCAGTGTAAGCT
GCTTAAAGGCAGGTCAGCCACTGTCGAGGAGCTACTCTCA
GTCCATTCAGAGGAACTTGTTTGTTTTTTCACTGGACCAG
AACCATATCGAAGTCAAATGGACATTGGTACGATGTGGAA
AAATCCCAGAAATTCAGAGGCACTGAAGATGGCTGTTGGT
AGCGTGACAGAGCTAGCGCTGTGTGTGGCCAGAGGAGACC
TGAGGAATGGCTTTGCTGTAGTCACACCTCCTGGACATCA
TGCATCACGTTCTCAAACACTTGACTCCATTGTTTTTAAT
TCTGTGGCCATTGCAGCTAAACAGCTTCAAGAACAATTAA
AGGTTAAAAAGATCCTTATTGTAGATTGGGATGTTCATCA
TGGCAGTGGAACTGAGTCGATATTCTACACAGATCCCAGT
GTCCTCTATATTTCTCTGCATCGCTATGATGATGGCGCAT
TTTTCAATGGTACTGGAGATCCCAGCAGGGTAGGATGTGA
TGTTGGAAGAGGTTATAATGTAAATGTGGCCTGGTCGGGA
GGACTGAGACCTCCAATGGGAGATGCTGAATACCTCGCTG
CATTCAGAACGGTAGTCATGCCAATTGCTCATGAGTTTTC
CCCAAATGTGGTCCTGGTTTCAGCTGGTTTTGATGCTGCC
GAGGGGCATCCAGCTGCTCTGGGAGGATACAGAGTCTCCC
CTAAATGTTTTGGATGGCTGACGCAGAAGTTAATGGAGCT
TGCTGAAGGACGAGTAGTGCTGGTGTTAGAGGGAGGTTAT
GAGCTTGTCTCCCTTTGCGATGCGTCCCAAGCTTGTGTCA
GTGCTCTTCTAGGAAATGAGCCTGAGCCTTTATCTGAGGT
GGAGTTACTGAGAAGTCCCTGTGCTAATGCAGTCTGTTCT
CTGGAGAAAGTGCTGCATGTTCAGAGTTTGCACTGGCGTT
CAGTGCGGTCCATGCTGAATACTGTGTCTCTGTCCTATGT
TAAAGCAGAGAGGAGAGTCTCGGCAGGCAGTGAAGCTGCT
TTAGTGCTGAGTGGCCTCAATATGACTGTTCCACACAGAA
GACAATTGCCCAATGAGCCAGTGGAGGACGATGAAACCCA
TTCGACAGTTTCCTTTACTAGAAGAACCTTTTCCTTTCAA
AGCAGAAGCTGATCAATAATCTGCTGTAAGCTGAAGGAAA
TGCAGGACACAATCCAAAAAAAGAGCACTTCTCTAATCAC
ACGAATGCTTCACTCAAATGCTGAGTCATTTCTGAGGTTT
TTTTTTTTTTACTTAACATTAGCTTGCACATGACAGACAA
ATCAAACTAGCATAGTACAAACAGGAAATGAACATGTATG
AGAAATGAGTTTTAAAGGTTCTTGTTCAGGATATTTGACT
GTTTAGTGGAACAAATTTGGTAGACACTGCTTTTTAAAGG
TTTGGTTCAGTCCTTTATTTTGTTTGTTGAAAAAACAACA
ACAAGAAAAACGTAAAATGTGAAATCTTTGCTGGTTTTTA
AGCTGTCTGTTAACTAAATAATCTGGCAGATATGCAGCAT
AGTTTTCAGAAAACATTCACAGTAATTCACGTTTCTTAAG
TATCAAATCATATTTCTAAACGATCAGGTGACGCTGAACA
CTGGAATAATAACCATGAAAGAACATGGGAATAAATTAAA
TTGTAATTACATAATATATTTTTTCAAATACATTTTCTAT
TTTTTTAGAATAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations