Community Action Needed: Please respond to the NIH RFI
Transcript

p2ry12-202

ID
ZDB-TSCRIPT-131113-293
Name
p2ry12-202
Previous Names
  • p2ry12-001
  • ch73-64e16.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000051101 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000051101|OTTDARG00000035859|ZDB-GENE-110208-4 p2ry12|OTTDARP00000040164 CH73-64E16.1-001 LG_ CU571333.8 Danio rerio protein_coding PUTATIVE, 1371 bp
TTTGCAAAACAGCTCAGCGCACTGGCTCTGGGGGTCTTTC
TGAGGCTGTGCAAAAAAATGTTCATGGGCATCATGGTGGT
GCAGTTTGATTGCCTCTCTGCAAGAAGGTTGCTGGTTCAA
GCCTCGACTGGGACTTCATTACTTCACCCAGCAGGACTCA
TCAATGGAGCAAACAACGCAGCTCAGCTTCTCCAACAGCA
GCGTCTCCAACAGTTCATCCTGTTCTCGAGACGGCGCTCT
GAAAACCATCGTCTTCCCCGTCCTCTACTCCATCCTCCTC
ATCCTGGGATTATCCCTGAACGCTCTGGCGGCTTGGGTTT
TCCTCCGGATCCCCAGCAAATCCCACTTCATCATCTACCT
GAAGAACATCGTGGTGGCCGACATCATCATGACCCTCACA
TTCCCCTTTAAAATATTATCCGATGCCAATGTAGCGTCCG
TGGGCATCCGCATTTTTGTGTGCCGCGTGTCCTCCGTGCT
CTTCTACCTCACCATGTACATCAGCATCCTGTTCTTCGGT
TTGATCAGCATCGATCGCTGCAGAAAAACCATGTGGCCGT
TCGTAGGCACCAACCCCAAACGTCTACTGCACAGAAAACT
GCTTTCGGGAGTCATCTGGACGTCTCTCCTGGCTCTTTCG
CTCCCAAATGTAATCCTGACCAGTCGTCCGAATATTGGAG
AGCGCTTCAAATGCAGCGATCTCAAAACTGAGCTCGGACT
GCAGTGGCATGAGGTGGTCAATCATATATGCCAGGTCATC
TTTTGGGGAAACCTTATAATCGTGATCATATGCTACACGC
TTATTTCCAGAGAGCTCTACAAGTCGTACGCCCGCACGAG
GTCTCCGCGTGGGACGCAAAGCAAGAAGAAACACATCCAG
GTTAATGTGTTCCTGGTGTTGGCCGTGTTTTTCATTTGTT
TTGTGCCGTTTCACTTCGCGCGAGTGCCCTACACCATCAG
CCAGACGCGCGCCCTCCTGTTCAGCTGCCCGCAGAAGCTG
TTTTTCTTCAAGCTGAAGGAGAGCACGCTGTGGCTGTCCT
CCCTCAATTCTGTGCTGGATCCGCTCATCTACTTCTTCCT
CTGCAAGTCCTTCAGGTCGTCGCTGTTTAATGTGATGCGA
TTGGCTCCGGGACGCTGCAGGATCCTGAGGGAGCTCGGGA
CAGATTCGGCCGGCGATCAACAGGGAAACGCACTGACATG
ATGGACAAAACACGGACACACACATGGGAAAAACACTGGG
GCTTGTTCTGTAAACATGCAATTATACAATGGGCAAGTGT
TTTTCAACCACAGATACACTATCAATCAGAGGTTGATGTG
TTCTTAAAGGTCCTGTTGAATTAAAATAGAAAAATGTCGA
TGTTACGCTGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations