Transcript

rnaset2l-202

ID
ZDB-TSCRIPT-131113-2770
Name
rnaset2l-202
Previous Names
  • rnaset2l-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057278 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057278|OTTDARG00000039923|ZDB-GENE-090819-2 rnaset2l|OTTDARP00000044893 rnaset2l-002 LG_ CR626887.6 Danio rerio protein_coding KNOWN, 886 bp
TCACAGACTCTCAGAACAGACGGATCAGCATGACCTACAG
TAAGAATCTACCTGAATAGCTATATAACCTCTGTTTAAAT
GCATATTTACTGTAACAATCTGTATTGTTTTAGATAAACA
CATTCTCTGGGCCTTTACCGCTGCTCTGGCCACAGGCTGG
GTCCTTAGTAATGATGAAGGATGCTATTATGGGACTGTCA
TGAAGCACTCATGCAACTGGACTTGTATGCTGCTCACTCT
TCAATGGCCTGGAAGTTTCTGTATAGGTCTTACTAATAAA
ACGATTTGCAAAATACCACTGACTATTCAAAACTGGACCA
TCCATGGCCTATGGCCGATGCATACAGGTCACTGCTGTAA
CTGTTGGCCAATATTTCATTCCCACCTTCAGGAAATCGAG
CCAGAACTCACTCAGCTGTGGCCATCTTTAATAAAAGGAA
AGCATTTCTTCAACTTTTGGAGGGAGGAATGGATTAAACA
CGGGACGTGTGCTGGCTGTGACGGGGCCATGGGTTCACCG
CTACTTTACTTCCAGGCTGCAGTCAAGCTTCGAAAACTCT
TTGACATTAATAGCGTCTTGGAAAGCTCTGGAATCAAAGC
CTCATGTGAGGTGTCCTATAAGTATGACGACATAAGCAAG
GCCCTGACCTCACTGCTGGGAGACAACTTTGATTTGCAAT
GTGTGACAGACAGTAAGGGTCGTGAAGCATGGATCCAGCT
GAAGATCCATCTTTCGAGGAACCAAACCATTGGATGCCCC
ACAGAGAAGCAAGACGAAGCATTCTATAATTTAGCGTGGT
ATAAAAGCCCTGGACATCCTTGTCCGAAGAACACCACCAT
CTTTTTTGTCCCAATTAACTATGACAACCCTCATGAGCCA
TGTAAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations