Transcript

rnaset2l-201

ID
ZDB-TSCRIPT-131113-1168
Name
rnaset2l-201
Previous Names
  • rnaset2l-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057277 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057277|OTTDARG00000039923|ZDB-GENE-090819-2 rnaset2l|OTTDARP00000044892 rnaset2l-001 LG_ CR626887.6 Danio rerio protein_coding KNOWN, 919 bp
ACAGACTCTCAGAACAGACGGATCAGCATGACCTACAATA
AACACATTCTCTGGGCCTTTACCGCTGCTCTGGCCACAGG
CTGGGTCCTTAGTAATGATGAAGGATGCTATTATGGGACT
GTCATGAAGCACTCATGCAACTGGACTTGTATGCTGCTCA
CTCTTCAATGGCCTGGAAGTTTCTGTATAGGTCTTACTAA
TAAAACGATTTGCAAAATACCACTGACTATTCAAAACTGG
ACCATCCATGGCCTATGGCCGATGCATACAGGTCACTGCT
GTAACTGTTGGCCAATATTTCATTCCCACCTTCAGGAAAT
CGAGCCAGAACTCACTCAGCTGTGGCCATCTTTAATAAAA
GGAAAGCATTTCTTCAACTTTTGGAGGGAGGAATGGATTA
AACACGGGACGTGTGCTGGCTGTGACGGGGCCATGGGTTC
ACCGCTACTTTACTTCCAGGCTGCAGTCAAGCTTCGAAAA
CTCTTTGACATTAATAGCGTCTTGGAAAGCTCTGGAATCA
AAGCCTCATGTGAGGTGTCCTATAAGTATGACGACATAAG
CAAGGCCCTGACCTCACTGCTGGGAGACAACTTTGATTTG
CAATGTGTGACAGACAGTAAGGGTCGTGAAGCATGGATCC
AGCTGAAGATCCATCTTTCGAGGAACCAAACCATTGGATG
CCCCACAGAGAAGCAAGACGAAGCATTCTATAATTTAGCG
TGGTATAAAAGCCCTGGACATCCTTGTCCGAAGAACACCA
CCATCTTTTTTGTCCCAATTAACTATGACAACCCTCATGA
GCCATGTAACTAAGAGAAGCCACATCATTTCACTTAAGCT
AAAACTATAGACATGTACACATTTGACCATTGTGTTCTAC
TTTACAGCTGTGTTCTGAATAAAATCAAATTCAACTTTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations