Transcript

ptgir-201

ID
ZDB-TSCRIPT-131113-2714
Name
ptgir-201
Previous Names
  • ptgir-001
  • ch73-242k11.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057042 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057042|OTTDARG00000039777|ZDB-GENE-120511-1 ptgir|OTTDARP00000044753 CH73-242K11.1-001 LG_none CR925772.23,CU467862.12 Danio rerio protein_coding NOVEL, 1926 bp
TCTTGTCTCACTCACTCACTAGTCTACATTACTCTATTCT
ACTGTTTTGTACTGTACGGTAACTTCCAAACGCGAGCAGT
GAATCGGTCAGCGTGGTTCTTCACTTCAGCTTCAGATGCC
GTGGACTCCTGAAGAACCTGAACGAATAACTAAACTAACA
ACTAAACTAACAAAAACTAGACAAGAAAACTTAATTGAAG
AAACGAAAGCCCAAGGACTTCTCATATCGACATCGCTGAG
AAATATTATGTTTGGTGGAGTGACAGAAATCCTCTATGTG
TGCTGCGTGGCGGCGAGGAATGGACGCGCGCTCCAGTGAT
GGACTCTGCCTGGACAGATTCTCAAAGATAAGGAACTGCA
AGACTTCTACAATAGACAAAATCGCTGCTGTCTGATCCCT
GCGCCTAGGCTCAGGTTTCAAAGGCAAGGCCTTCTCAATA
TGCTTTCCAACCAGTCATGCGAGAACATCACCAGCATCGA
GGCAAATGGGAATCCGGGGACGAGCACTGTGATGTTCATT
GCTGGAGTGGTCGGTAACCTAATTGCTCTGGCTATTCTGG
GAGTCCATCAGAAAGATCGTCGCACCAAGTCTTCGGTCTT
CTGCATCCTCGTCACAGGTCTGGCTCTGACAGACCTGCTG
GGAACATGTTTACTCAGTCCACCAGTTTTCATCTGCTATG
CCTACAGAACATCGCTGGTGGGACTGACTGGAGATCAGCG
GCTCTGCGGACTCTTTGCCTTCGCCATGACCTTCTTCATC
TTGGCCTCTATGCTCATCCTATGTGCTATGGCAGTAGAGC
GATGTCTCGCCATCAGCCACCCGTATTTCTACTCCAAACA
TGTGAGGCGAAGCTTTGCTAAGATCGTCCTCTTACTCATC
TATCTCTTTACCTTCGTGTTCTGCTTGATGCCTTTCTTCG
GGTATGGCCGGCACAAGCAGTACTGTCCTGGGACATGGTG
TTTCATCAAGATGGAAGTAGAAGAGGGTGATGATGAGGAG
AGAAGATCATTGGCCTTCTCGCTGTCCTACGCCGTACTCA
TGGCATTGCTCATCGCCATTGTGTTCATGTGCAACGGTTC
GGTCATCGTGAGCTTGTGTCGGATGCACCGGAGCCAGCTG
ACACGCCGGGGATCAGTGGTGTCGGCTGGACGCAAGAGAA
GGCTGAGCACCTGGTTTGGACAGGGAGAGGAGGAGATGGA
CCATTTACTGCTGCTGGCATCCATGACCTTAATCTTCGTC
ATTTGCTCCTTGCCGCTGACTATCTGTGGCTTTGAGAATG
CCATTAGTCCAGTTGGGAATGATCAGCGGAATCTAACGGC
TTTCCGCTTCTCTGCGTTTAACCCCATCTTGGACCCTTGG
ATCTTCATCATCTTCCGTAAGGCGGTCTTCCACCACATCC
GGGCTCTGTTCCGCTGCTGCTTCCCCAGAGAAGCAGTGAA
GACCACAGCTCAAAGCTCCCAAGAGCTTAAGGCTGAAGAC
ATTAAACACAGCTCCAGCATCCAGAGCAAGATCTACCACA
GCCTCCCCCAGTGAGACCTTCAGTAGCGATGAAGGGACTT
TTTAGGAAGCCTGAAAAGACTGCATGAATGTGTCGAGTGG
TGCCAAGAACCAAAAATAAAAGCACGGTCATCAGAAGACA
TTGTTAATGGATGATTTGTGACTAACTTTCATTCCTAACC
ATGTTCTTCTATGCAGTGTAATGGAGACCAGTCAGAAGGA
AACCTTGTTAGTATGTCCAACTCCAATGTTGGTAAGAAAT
TTGCTAGAATGAAGGTCAATGGTTGGGGTTATATTGGTGC
CATGACCCGGATGTAGGAGGAGATGATTGTAGAAAAGAGG
CCAGCTAGTAGTAACTGAGGAAACTTTGCCAGTGCACTAG
ACAGGCCAGGTAGAACGACAGGGGTGAGATTGTTGCCAAA
CCCCAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations