Transcript

lamb1a-201

ID
ZDB-TSCRIPT-131113-2619
Name
lamb1a-201
Previous Names
  • lamb1a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056699 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056699|OTTDARG00000039497|ZDB-GENE-021226-1 lamb1a|OTTDARP00000044466 lamb1a-001 LG_ CU929267.11 Danio rerio protein_coding KNOWN, 1654 bp
ATGCTGTTACAACTCGCAGCCCTTTCAATTTTAGGGGCCT
GGGCTCTGGCAGATGTGCCTGAGCTGGGAGATGTTTGCAC
AGAAGGGAGCTGTTATCCGGCCACAGGAGATCTGCTTATC
GGAAGAGCTCAACAACTCTTGGCCACCTCAACATGCGGAG
TCCATAAACCTGAGCCCTTTTGTATCGTCAGTCATTTGCA
GGAAGAGAAGAAGTGCTTTGTGTGCGACTCCAGGCAGGCC
TACAATGAGACGGCGCACCAAGTAACCAGCCACAGCATTG
AAAACGTTGTCACAACGTTTGCACCGAACCGCCTCAAGAC
GTGGTGGCAGTCGGAAAACGGCCTGGAAAACGTCACGATC
CAGCTGGACCTGGAGGCTGAGTTCCACTTCACCCACCTCA
TCATGACCTTTAAAACGTTCCGACCGGCTGCAATGGTGAT
CGAGCGTTCGGCAGACTTCGGGAACACTTGGCAAGTTTAC
CGTTACTTTGCTTATGACTGTGAGTCCTCCTTCCCTTCTG
TCTCTCATGGGCCAATGACCAAAGTTGACGATGTTATATG
TGATACTCGCTACTCTGACATCGAACCCTCAACTGAGGGC
GAGGTCATTTTTAGGGTTTTGGATCCTGCCTTCAGGATTG
AGGATCCCTACAGCCCCAGAATTCAAAACATGTTGAAGAT
CACTAATCTGAGGGTGAAGTTCACTAAACTGCACACTCTC
GGCGACAACCTGCTGGACTCACGTATAGAGATCAAGGAGA
AGTATTACTATGCTATTTACGACATGGTGGTCAGAGGAAA
CTGCTTTTGCTATGGTCACGCATCTGAATGCGCCCCTGTC
GATGGAACTGGAGAGGCAGTGGAGGGCATGGTTCATGGTC
ATTGTATGTGTAATCATAACACTATCGGTCTGAACTGTGA
ACGCTGTCAGGACTTTTACCATGATCTGCCCTGGAGACCC
GCTGAGGGACGCAACACCAATGCTTGTAAAAAGTGTCACT
GCAACCATCACTCTCATTCGTGCCATTTTGACATGGCAGT
TTACCGAGCCTCAGGGAACGTGAGCGGCGGCGTGTGCGAT
GACTGCCAGCACAACACTATGGGCCACAACTGCGAACAGT
GCAAACCCTTCTTCCACCAGCATCCAGAGAAGGACATCCG
CGACCCCAACATCTGCGAGCCCTGTAACTGTGATCCGGTT
GGATCCCTCAATGGTGGCGTTTGCGACCCGATGACAGATG
TGTCGCTTGGCCTGATCTCGGGTCAGTGCCGCTGTAAACC
CAATGTGGAGGGTGAACGCTGCGACCAGTGCAAACAAGGC
CATTACGGGCTGAGCGAAGACCCTCTGGGATGCCAACCAT
GCACCTGCAATGCTTTGGGAACAGTTCCAGGCGGAAGCCC
GTGTGACACAGACTCAGGAAACTGTTACTGTAAACGTCTG
GTTACCGGAAGGAACTGTGACCAGTGTCTGCCCCAGCACT
GGGGTCTCAGTAATGACATGGACGGCTGCAGACCATGTGA
CTGTGATCATGGTGGTGCAATCAACAACAATTGCTCTCCT
GTATCGGGTCAGTGTCAGTGTCGGGAGCACATGTTTGGCA
GACGTTGTGACCAGGTGGAATCTGGCTTTTACTTCATCGC
TTTGGACCACTACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations