Transcript

pbx2-203

ID
ZDB-TSCRIPT-131113-1709
Name
pbx2-203
Previous Names
  • pbx2-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048240 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048240|OTTDARG00000034163|ZDB-GENE-000405-5 pbx2|OTTDARP00000037863 pbx2-002 LG_ CU694532.11 Danio rerio protein_coding KNOWN, 671 bp
GGCCAATCTGTATGCCATGAAGACAGCCTTAGGGGCGACA
CAGAGCGAAGATTCACCCCACACTCCAAACTCCACTGGCT
CAGGGTCGTTCTCTCTGTCAGGATCAGCTGACTGCTTTCT
AGGGGTTCCACCAATGAACGGCGAGCAGCCTCCGTATCAC
ATGGGAGCTCAGGACGCTCAATCGCGCTTCTCAGAAAGAC
TGTATATTACCAGAGAGAGCCGGACTAATGGTAACTGGCA
GGAGCAGAACTCGCCGCCGTCCGCTGCTTCACCCGGAACT
GATCACTCCGTCGACTCAGACTGATGACGTCCACCTCACA
GACACGAAAGAATGATGCTCTCTCTTCTACCCAACTGCAG
ATTTACTTTTCTTCTTAGTTTTATTTTCGTTGGACTTCAC
GTCGAGCCTCATTCATGAAGCAGAGTTTTACATGTAGATC
CTTTATAAATGTATCCTTATTACATTTAATGCAATCATTT
ACATAAGAAAAGGCCTTGTTTATGAAGCATGTAAATGTGT
AAACTGCTTGTAAAATTGCTAAACGACAGTTTAAGCCAAA
CTATTATTTGGAATAATTTTGTTTTTAACCCGTTTATAGG
ACACTCATTGAAATACTCGTCAGGAAAAATCCTGGAGCGT
CACTAGGGGTTATTATTATTAATTTTTAAGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations