Transcript

pbx2-204

ID
ZDB-TSCRIPT-131113-116
Name
pbx2-204
Previous Names
  • pbx2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048239 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048239|OTTDARG00000034163|ZDB-GENE-000405-5 pbx2|OTTDARP00000037862 pbx2-001 LG_ CU694532.11 Danio rerio protein_coding KNOWN, 3006 bp
CAGGCCTGCAGTGAGTTCACTACCCATGTTATGAATCTGC
TGAGGGAGCAGTCTCGCACCCGGCCGGTGTCTCCACGTGA
GATCGAGCGCATGGTGGCCATCATTCACCGCAAGTTCAGC
TCCATTCAGACGCAGCTCAAACAGAGCACCTGTGAAGCCG
TCATGATTCTACGCTCACGGTTTTTGGACGCCAGGCGTAA
GCGGCGTAATTTTAGTAAACAGGCCACAGAGGTTCTGAAC
GAGTATTTCTATTCACACCTCTCAAACCCTTACCCGAGTG
AGGAAGCCAAAGAAGAACTGGCCAAGCAGTGCAGTATCAC
TGTGTCTCAGGTGTCCAACTGGTTTGGCAACAAGAGGATT
CGCTATAAGAAGAACATTGGGAAATACCAGGAAGAGGCCA
ATCTGTATGCCATGAAGACAGCCTTAGGGGCGACACAGAG
CGAAGATTCACCCCACACTCCAAACTCCACTGGCTCAGGG
TCGTTCTCTCTGTCAGGATCAGCTGACTGCTTTCTAGGGG
TTCCACCAATGAACGGCGAGCAGCCTCCGTATCACATGGG
AGCTCAGACTAATGGTAACTGGCAGGAGCAGAACTCGCCG
CCGTCCGCTGCTTCACCCGGAACTGATCACTCCGTCGACT
CAGACTGATGACGTCCACCTCACAGACACGAAAGAATGAT
GCTCTCTCTTCTACCCAACTGCAGATTTACTTTTCTTCTT
AGTTTTATTTTCGTTGGACTTCACGTCGAGCCTCATTCAT
GAAGCAGAGTTTTACATGTAGATCCTTTATAAATGTATCC
TTATTACATTTAATGCAATCATTTACATAAGAAAAGGCCT
TGTTTATGAAGCATGTAAATGTGTAAACTGCTTGTAAAAT
TGCTAAACGACAGTTTAAGCCAAACTATTATTTGGAATAA
TTTTGTTTTTAACCCGTTTATAGGACACTCATTGAAATAC
TCGTCAGGAAAAATCCTGGAGCGTCACTAGGGGTTATTAT
TATTAATTTTTAAGTCACTTTTTAAAGTAATAATTAAAAT
AATTGTAAGTGAAAAGTATATTATAAACTTAAATTAAAAT
ATATTATAAACTATATCTTAATGAAATTACCATAAATGGT
TCCTTGCCCAATAAAGGGTTAAAATGTCTTAAGTCTCTCT
TCAAGGCTGCATTTATGTAATAAAAAACTATAGTAAAATA
GTGAAATATTACTTAAATATTTTAAAATCTAATTTATTTC
TGTGATGCAAAGATTTCAGTTTCAGGTATCTGGTTTCAGT
TATGAGTTTTCAGTTTCAGTGATCAATTTTCAGCATCACA
TGATCCAGACATAATACTAATATGCAGATTCTGTGTTCAG
TTATTTATTATTGGTGCAAAAGAACCTTTTATAAACAGTT
TTTATTTTAATTTCCAATAACTAAATGTAGCCTTTGTCTG
AGCCAAACTATTATTTGGAATAATGATGTTTTTAACCCCT
TTATAGGACACTCATTGAAATAATTATCAGGAAAAACCCT
GGAGCGTTACTGGGGGTTATTACTTATTTTGAATTACTTA
AAATTACTTTAAACTTTATAATAAGTAGCAATTTAATGAA
ATAATTTAAAGATTTTTGACCTTATTACTTGAATAACAAA
GTAAAAAGAGAGTATATTATAAACAATCTCAAACAAGTTA
CTATAAATGTTTCCTTGCTAAATAAAAGATTAATATTTTA
AGTCTCTCATTAAGGCTGCATTTATGTAATAAAGAAATAG
TGAAATATTACTTATTTTAAAATCTAGTTTATTTCTGTGA
TGCAAAGCTGAATTTTCAGCATTATTACTTATCAGTTTTC
AGCTTGAGGTATTTGGTTTCAGTTTCAGTGATCCATTTTC
AGCATCACATGTTCCAGAAATCATACTATTATGCAGATTC
TGTGTTCAGTTATTTATTATTGGTGCATAATAACCTTTTA
TAAACAGTTTTCACTTTATTTTTAATTAATAAATGTAGCC
TTTGTCTGAGCCAAACCGTTATTTGGAATTATCATGTTTT
TAACCCCTTTATAGGACACTCATTGAAAGAATCGTCAGGA
AAAACTTTACTTCTTCTTTTTTTTTTTTTTTTGTAATCAA
GTTTTAAGTAATAATTAAATTAAATAATTAAGACTTTTGA
ACTTGTAACTTAAAAGGAAAAAGAAAGTATATTATAAACA
ATCTCAAAGAAGTTTCCTTCCCAATAAAAGGCAAAAATGT
TTTAGGTCTCTCATCGAGGCTGCATTTATGTAATAAAATT
ATAGTAAAATATAACTTAAATATTTTAAAATTTAATTTAT
TTCTGTGTCAGTTTTCAGCATCACATGATTTAGAATCATT
ATATGCAGATAATATGCAGATTCTGTGTTCAGTTATTTAT
TATTAGTTATTATAAACGGTTTTCACTCAACGCTTCGTTC
ATTAAATGTAGCCTTTGTGAGCAGAACAGGCTTTTGTGAG
CAGTTTATGCATTTGTCTCATGAAGAAGGCCTTTCTCCAT
TTAGATGGTTGGATGTTTGTGTGAGAGAAGAGCTGGATGA
GATCAAGGCTTTTACTTGTGTTGTTTTAGTTTTTTACATT
TCCACTACATCACAACTTCCATTATGTGTTACTGCAATAT
CTGGGTGTTGAATGGGGGAACTTTTTAAGCTGCATTACGA
CTGCTTTCATTACAGCTATTTTATTATTATTATTATTATT
ATCACTGCTCAATATAGTTTATTCAGAGCTCAGATAGGAT
TGGCTTGGCTGAAAGGGGCAATATTGATAAATCCAAAGAT
TGTTTTTTTGGTTGTTTCTCTGTGTGTATGTGCGTGTTTC
TCTTTTTTACTGGGTTTGTGTATGTATCAGTTTTCTGAAT
GAGGTGTGTTTGCTGTTTTATTTACCGTTTGAATGAGTAT
ATCAACAGTGCTGTCTTTTCTCTGTACAGTGAAACACCTG
TATTCTCTACCTCTTTTACAATAAAGACTGTCTGTGTACA
CATTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations