Transcript

sema6ba-201

ID
ZDB-TSCRIPT-131113-1643
Name
sema6ba-201
Previous Names
  • rp71-45h24.1-001
  • sema6ba-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039838 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039838|OTTDARG00000029078|ZDB-GENE-131024-1 sema6ba|OTTDARP00000031852 RP71-45H24.1-001 LG_none CT027824.25,CT583662.16 Danio rerio protein_coding NOVEL, 1720 bp
CTCTGGTGTGTCGCTGCCATGGCGACTCTGACCCCCTGCC
TCTTACAGATCTTTGCTGTGCTCCAATTGGCTGCCTGCTC
GTTTCCAGAGGAACCTGAGCCTTTAATCTCCGCCCCCGCT
GAGGTGGTGAGACGGTATCCGGTGTTTTTGGGCCGAGCGC
ATCGCTCTTACACCCGTCAGGAGCCGCTTTACATTCAGAC
CGTCCTCAGAGTCAACCGTACACTTTACATTGGAGCCAGA
GATGACCTTTATCGAGTGGAATTGGACCATGTATCTGGAG
ATGAAATGTTCTACAGCAAGAAAAGAACATGGGAATCCAA
CAAGAATGACATCCGCATCTGTAGAATGAAGGGCAAACAC
GAGGAGGAGTGCCGTAATTATATTAAGGTGTTGCTGAGCC
ATGATGGAGGGCTGTTTGTGTGCGGGACAAACGCTTTCAA
CCCATTGTGCGCCAATTACACGAGAGACACTTTGGAATTG
GTTGGCGAGCCCATCAGTGGAATGGCCCGATGTCCTTATG
ATCCCAAACACGCAAACGTCGCTCTGTTCGCAGAGGGCAG
CTTGTTCACGGGTACAGTGACGGACTTCTTGGCTATTGAT
GCTGTGATCTACCGCAGTCTGGGAGAGAGTCCTGCCCTGC
GCACCATCAAACATGACTCCAAGTGGTTCCGAGAGCCTTA
TTTTGTGAGTGCCGTTGAATGGGGACCACATATCTACTTT
TTCTTCCGTGAAATGGCCATGGAGTTCAACTACCTGGAGA
AGGTGATGGTGTCTCGTGTGGCGCGTGTGTGTAAAGGAGA
TCTGGGCGGCTCTCAGCGAGTGTTAGAGCGGCAGTGGACA
TCGTTTCTGAAGGCCCGTCTGAACTGCTCCATCCCTGGAG
ACTCACACTTCTACTTCAACCTGCTGCAGTCCACCAGCCC
CATCATACGCATGCAGGGCAGAGACGTCATCCTGGGGGTC
TTCTCTACACCCTCCAACAGCATCCCCGGCTCTGCGGTGT
GTGCGTTTGACATGCAGCAGCTGGCACGTGTGTTTGAGGG
CAGATTCAAAGAGCAGAAATCACCAGAATCCATATGGACA
CCAGTACCTGATGAACTGGTGCCAAGACCCAGGCCTGGAG
GATGTGCTGTCCAGGGCTCCAGATTCAGCACCTCCAACAC
CCTCCCTGACGAAGTGCTTAATTTCATCAAAATCCATCCT
CTGATGGACGAAGCGGTTCCTTTGTTAGGACACAGACCCT
GGATAGTCAAGACCATGGTCCGGTACCAGTTGAACACTAT
GGTGGTGGACACCGAGGCAGGCCCTCATCGCAATCGTACT
GTGGTTTTCCTCGGTTCTACTAGGGGAACCGTCCTTAAGT
TCCTCATCACACCCAGCCCGGAGAACCAATACTCCAATAC
CAATACATTCCTGGAAGAGCTGGAGGGATACAACCCTGAA
AGATGTGGTGATGACTCTGCGCAGGCGATGCAGCCGCTCT
CTCTGACCTTGGACAAACCCAGTCACACGCTCCTGCTGGC
CTTCCACTCGTGTGTGGTGCGAGTGCCTGTCGCTCGCTGC
CACCTGCACTCCAGATGCATGAAAAACTGCATTGCGTCCA
GAGATCCATACTGCGGCTGGACCAGAGGAAGCACCTGCAC
ACTCCTGAGACCCGGCACCAGATTGCCGTTTGTGCAGGAC
GTCGAATATGGAAACACCTCACATCTCGGAGACTGCGATG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations