ZFIN ID: ZDB-TSCRIPT-130528-565
Transcript Name: foxj1b-202
Previous Name: foxj1b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058345 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058345|OTTDARG00000040581|ZDB-GENE-041212-76 foxj1b|OTTDARP00000045613 foxj1b-001 LG_ CU207309.12 Danio rerio protein_coding KNOWN, 828 bp
TTTCTTTCCTGTTGTTCACTGCTTACGAGTTACGACACAA
TAACTGCTTCCACTGGACTTTCTTGAAGACGAGATTGGAA
TGCTACTTTTTTCCAGCAGACATCAGGACATGTGTGATTG
TGTGGACGCGCTCCGTTATCCGCTGCACTTGTTGCTCTGA
GAAGAACAGGCTGAATCTAACGGACTGAAGAGACATACAC
CGCTACCGCTCAAACATACGAGTTATTCGGCGTGTTTTCA
TTTCGCAGATCTGCTCTTTCTAAACTCGCGATCAAGATGC
CGGTGTTAATGAGTCCTGAAATAGCGAATAAATTCAAAGA
GAAATGGCTGATGCTTCATCCGGAGGATCAGGATAATGTC
AGCGGCTCTGTGCACTTTGACGACAGTCTCACTAGTCTGC
ACTGGCTGCAGAACTTCTCCATCCTCAGTGCCAACCCCGA
GAGGACTCCCAGCTCCGGCTGCCACCCGCAACACCTCTTT
TACTACAAAAACCAGCTGGGGGGTACCGACTCGCCCTCCA
GTCCACCTGCCGGAGATACCGCCGCCACAGGGATGCCACA
GACACCTGGGAATCCCACAACGTCCTGCAGCAGTTTGGCC
AATCCATACGCGCTTCAGCAAGCCGGACACTACATAACGG
GGCAAACAAACCCGGCTGAGGAGATAGACTATAAAACAAA
CCGCCACGTGAAGCCACCCTATTCATATGCCACTCTGATT
TGCATGGCAATGCAAGCCAGCAACAAGACCAAAATCACCC
TGTCAGCCATATACAGCTGGATCACCGAGAACTTCTGCTA
CTACAGATACGCAGAGCCGAGCTGGCAG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
foxj1b-202 Contained in:
[BAC] CH73-197A13 (1)

Genome Resources: Vega_Trans:OTTDART00000058345 (1),  Ensembl_Trans:ENSDART00000153327 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC086726 (1) 2352 bp
CITATIONS (2)