Transcript

moxd1l-202

ID
ZDB-TSCRIPT-130528-431
Name
moxd1l-202
Previous Names
  • moxd1l-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058716 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058716|OTTDARG00000006402|ZDB-GENE-060126-3 moxd1l|OTTDARP00000045866 moxd1l-002 LG_none AL845420.7,BX784041.24 Danio rerio protein_coding KNOWN, 725 bp
TTTCATGGGCACCTGTTTAAAAGGTAACATGAGTGTTTTG
TCTCTCGTCCTGTTTTTGCTTTCCGTCCAGCAGTTCTGGG
CTCAGGAAGACCCTCTTCTGCCTTTCTCTGAACACTTGGA
CCTTGAGCACAATGTGCAGCTGAAGTGGGGATTTGATAAG
ATCCAGGGCACCATCTTATTCCAGCTCTCTGTCAACACCA
GCGGCTGGATCAGTTTCGGCTTGAGCCCTAATGGAGGAAT
GACTGGAGCTGATATAGTCATTGGAGGAGTTGACAACAAA
GGCACTTACTTCACGGACCGCCATGCCTTGGGAAATTCAA
TGCCTGTGGTCGACCAGAAACAAAACTACAAACTCTTGTC
CCTAAGCGAGTCTGATGGGAAAACAGTCATGAAATTCCAG
CGGTCCATTGAATCCTGTGATGAAAATGATTTACCCGTCA
CCTTTATGCTACCAGCCAACCAAACCTACTACCACTGCAA
AACTGCAAGAGCACCTACATTCGACAGCAAACAGCACATT
TATCGGATTGAGCCGGTAATCACCAACTATGACCTAGTGC
ATCATCTGCTGCTGTACCGCTGCCCGCCGACAGTGACGGA
GCCATTGGAGCTGGAGTGTTACACGAAAACTGAACGGTGT
ATGGAGACAATTGCAGTGTGGGGAGTTGGCGGAGGGGATT
TTGAATTCCCTGAAGTGGCAGGACTTCCGATTGGAGGAAA
TGTTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations