Transcript

moxd1l-201

ID
ZDB-TSCRIPT-090929-911
Name
moxd1l-201
Previous Names
  • moxd1l-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000007060 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000007060|OTTDARG00000006402|ZDB-GENE-060126-3 moxd1l|OTTDARP00000006279 moxd1l-001 LG_none AL845420.7,BX784041.24 Danio rerio protein_coding KNOWN, 2062 bp
AGCAGTTTTCATGGGCACCTGTTTAAAAGGTAACATGAGT
GTTTTGTCTCTCGTCCTGTTTTTGCTTTCCGTCCAGCAGT
TCTGGGCTCAGGAAGACCCTCTTCTGCCTTTCTCTGAACA
CTTGGACCTTGAGCACAATGTGCAGCTGAAGTGGGGATTT
GATAAGATCCAGGGCACCATCTTATTCCAGCTCTCTGTCA
ACACCAGCGGCTGGATCAGTTTCGGCTTGAGCCCTAATGG
AGGAATGACTGGAGCTGATATAGTCATTGGAGGAGTTGAC
AACAAAGGCACTTACTTCACGGACCGCCATGCCTTGGGAA
ATTCAATGCCTGTGGTCGACCAGAAACAAAACTACAAACT
CTTGTCCCTAAGCGAGTCTGATGGGAAAACAGTCATGAAA
TTCCAGCGGTCCATTGAATCCTGTGATGAAAATGATTTAC
CCGTCACCATTCTTCCGATGAAGCTGATTTACGCATATGG
AGAGACTGATGACATCTCATACCATAAGGCCCAAAGGGGC
ACAAAGGAGGTGAACCTGTTGAAGTACATGCCTCGCGCCA
GCCTTTCAAACGCCACATATTTTGACATAACTATGGAAAA
TTTTATGCTACCAGCCAACCAAACCTACTACCACTGCAAA
ACTGCAAGAGCACCTACATTCGACAGCAAACAGCACATTT
ATCGGATTGAGCCGGTAATCACCAACTATGACCTAGTGCA
TCATCTGCTGCTGTACCGCTGCCCGCCGACAGTGACGGAG
CCATTGGAGCTGGAGTGTTACACGAAAACTGAACGGTGTA
TGGAGACAATTGCAGTGTGGGGAGTTGGCGGAGGGGATTT
TGAATTCCCTGAAGTGGCAGGACTTCCGATTGGAGGAAAT
GTTGGCGACTTTTTCTACAGGCTTGAGGTGCATTACAACA
ATGTCAATAAAACTGCAGGTCGAGTTGATAGCTCAGGTCT
GCGATTCTATTATACGTCTAAACTACGCCAACATGATGCG
GGTATTTTGATGACAGGGCTAGCAGTGATTCCTTCATACG
CCATACCTCCCAAAGCCAAATCTTTCCTCACATATGGGAT
GTGTGACACTACTTATATCCCCAAGGTACTGGAGACGGCA
AATGATCTTCAGGTGTTTTCTGTGATGATGCACACACACT
TAGCAGGACGCAAAGTGCGAGTTGGACACTTCAGAGAAGG
AAAACAGATTGATCTTCTAGCTGTGGATGAAAACTACAAT
TTTGAATTCCAGCAAGTGACAAACTTGGGCAAAACTAAGA
CAGTGAAGTTGGGTGACAAACTGCTGGTGGAGTGCACTTA
CAATACTGAAAATCGCAACACACTCACACAGGGAGGTCTG
TCGACATCAGATGAGATGTGTTTGGCTTTCCTCTTCTACT
ATCCAGCTATGAATCTGAGCGGTTGTGAGAGCTTACCTCA
TTTCTCGTCTTTAGTGTCTGAAATGGGAGCAGGAGATACA
GGAACCTGGCTATATATGATGAACACGATGGCTTGGAATG
ACAGCTCTATCAATGAATACCAACAAACACTCAAGAAAAT
CAACCAGACAGTCATAGTCGTGAATTCATTTAATAAAGCA
TCAATCACCAATGGGACGATTCCTGATCTCAAAGTCAGCC
CTCCCGAGCCCTGCGTGAGAGCCTGCGCCACTAAAAATCT
GGCTTTTATGTCACTGTTCTTGTGTTTGGCAGGTATGTGG
GCGTCATGAAATGTGCATGCAAAATACTAAACCCGGTGTA
ACGCGCCGTTCCTTCATTGTCTGTGAATAAAGGCCAATCG
AACAAACAGAGAAATTCGAGACTCACGCGAACAGCAGGCT
GGAGACAAGAACAGAAAATGTATTGCAATAGAAAATGAGT
TTTATATGTTACTTAAAATGCTTTACGAAAGATTATGTAG
ATTCACAGTGAATATATACTGTAAAATATACATGTTTATA
TAATATATATATACATTATAAAAGCCTTTACTGGCAGCAT
GATTCCAATTGATATTTTCATCCCTCTCTTGTAATTAAAA
CTATAAAATGCCAGTAAATGTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations