Transcript

cdc42ep4b-201

ID
ZDB-TSCRIPT-130528-246
Name
cdc42ep4b-201
Previous Names
  • cdc42ep4b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058962 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058962|OTTDARG00000040869|ZDB-GENE-091008-2 cdc42ep4b|OTTDARP00000046046 cdc42ep4b-001 LG_none CR293521.11,CT737119.6,CR678388.17 Danio rerio protein_coding KNOWN, 4334 bp
GTACGCCAACGCTCGCTCGTCAGGATTCAGCGTTGTTGGT
CCTGTTTAACTAGTTTTTATTATCCCGCGATTATATCACA
AAGCAGTGTAAAGTTTGAAGGATATTGGACACTTCCGCCA
AGCCGAGCCTGTGTTTTGCTACTATATTCACTCCTTGCTC
TTTTGTTTGGAGTGCGAATCCATTGAACTTGGTCTATTGT
TGTTGGATGAGAAGCTCAACTTGGCATTGAGGCTCCTGGG
ATCCAAATACTACAAAACAAACAGGGGTCAGCTTGCAGAT
GTTGACAGCTGGACGATCCACTTTAAGAACAAAAATGGCC
ATACAACCTAAATTTTTGGAAGAGTTTTTGTCCTGACCAC
TGTCCTGGATCTATACCGCCAGTAGAAAGAGTGACCCATC
TCTCAACAAGAAAAGACTTCTGTGGTTTAATTTTTCTGTG
GACCGTACTTAAGCAATCATCATGCCTATTCTAAAGCAGC
TTGTCTCCTCGTCATCCCAGTCAAAGCGGCGCTCACGTGC
CGACCTCACTGCAGAGATGATCAGCGCACCTTTGGGAGAC
TTCCGTCACACAATGCACGTAGGTCGGGGAGGCGACGCAT
TTGGGGACACCTCTTTTCTTAGTACTCGCTCCGGGGAGCC
ACCAAAAGAGCCAGAGGTACAGCAGAGCTCGCCTAAACAG
AGTCTCCTTTCCCGTACATTCCGAAGCAGCAAACGCTCGC
AGTCAGTCAATCGTGACAAGCCTGAGAAATCCAAACTGGC
ACCTCCAAGTGGCTCGCCGAGTTATGTGAAGAACGCAATC
TCACTTCCATATTTGAATGATGAGGACTCGGGACGAGGTA
CTGGAATGCACCTTCCCAAAAGCGTGTCCTCAAGCCCACT
GAAGAAACTTCCAGAAACTGATGTGAAGACATTTGACGGG
AAGCCGCTTAATGGAGCAGCGGCTCTTGCTGTGTCAGACT
TGGAGTTGGATGAGAAGAATTTCGGTGAGCTGACTGACTT
GCGTCCATCGGCTCCTTACACCGGAGGCATGAAGCACGCT
GAGTCTATCATGTCCTTCCATATTGACCTGGGTCCTTCAA
TGCTTGGAGACATCCTGAGTGTGATGGAAAAGAAAGGCTT
TGATGATGATGACTTGGGTTTTGAAGAGGGGAAGAGTAGT
GAAGGACGTGGATCGCCACCCCAAAGTCCTCCTAATGAGG
TGGAAGAGGAGGACCCTCTTCCTCCAACTCGCCCTCCACG
CCAAAAGCCGGGCACTAACCCTTACACTCCAGAGCTCCAA
ACCAGAAACCACCAACACCTCGACAGCTGTTCTGTGTCCA
GTTCAGGATCCACAGTGCTGGATGAAAAACCTCACAATCT
GATCTATGATGGCAACATGGATAACATCAAGTACAGCGCG
CCCAGAGTCCAAGACGACACAGACTTCTCCTATATGGATG
AGGACGATGAGGATGAAGAGATTAGGGTGTAAAATGAACC
GTATAAAGATGATTGGTCAGTTCAATTGATATATGTAAAG
CTCCCGCACTGACATGGAGGACTGACTTTATAATGGAGAT
CAAAGGGAAAACTTGCGTTTAACCCTTGCTGAATGCTTTT
TGAATACAATTCCTAGTTCAGATAAACAAACCCTCTGTTA
CTTGTAACTTTCACCAGAGCCGCTGCAGCTGTGAGAGGAA
TGTGCTTGTATGTTTGCATATGCCGAGGCAAGGGGATTCC
ATTTCAAATGGTAATTACAGTCCCGTGAGCATCATTAATG
AATTCCAGTGTTGACCGCTGGGAATGCCAATACAGGAGGT
TTGTGTGGAACCAAGCTTCAGATTTTCTCCCATTATCGAC
GCAGTACTCTGATACAGCTTGTTTATGCCTTTTGGACTCT
GACACTACAATCTAATGCCAACAGTCTTAAGTTTCCTCAC
AGTTGTGGATTCTATCTTTAAGTTGTATCCTATGTTTCTG
CTTTGTATACTACAGTGTAAATGATGAAGTGATGAATGGA
ACGCCAGAAACGTATTTCAGCAGATTGCTTTAGGTCTGGC
ATGCGCTATTTTTTCCCCCTCTCTTGAGATTTGTTCATGT
TTCAGATCTGGACTTTGTCTTACGGTCTGTGTTGTGTGTT
TACGAGGATTTCCTGTCAGGTCACATGAAATTCTTCAATC
TGGTTGATGGAATACAGAAACCGAAAGCTGTGGTGACGTT
GCATTACTTGGCGGAAGAAATTTGAACCAATAATGACTTT
TCCGGTTTTGTGTGAATGAGGATTGATCTTAAGAGGGCCG
AGAAGTGTGCTATTTGATTATTGTTGTATAGGCTCAGAGA
TGAAGAGCGTATCTTTTATTCAGGGTCTAGCTTAGTGCCT
CGAACTTCAAACCCTTGCTCATCAGCAGAAGTGGCTCTAG
AGGGTTTTCATCTCTGAATGACTCTTGTAGGCCTTTGTGT
TTCTTTGTTAGGCTTTTTAAGAGAGATCAAAATCCAGTGA
TGAGCCTGTAAGTTAGTGCTACTCTGTAAGTTAGTGCCAT
ACACTCTCAGAAATAAAGGTGCGCGAGCTGTTACTGGGGT
GGTACATTTTCAAAAGATACACATTTGTACCAAAAAGGTA
CTCAAAGGTATATATTAGTACCTAAAAAGTACAAAAGTGT
TTCTATAATAAAAAATGTAGGTACTAGAAAATACTTTTGA
GGTACCAATATGGACTCTTTAAGTACAAATGTGTACCTTT
TGAAAAGGTACCACCCCAGTGACAGCTCACGCACCTTTAT
TTCTGAGAGTGTACCATTTTGTAAATGTACTTGATTTGAA
ATCAACAAGTAAACTTGACCACCTTGCGATGTAAAGCTTT
CGCATAACTGTCCTTTATGAAGTGTGTGATTTCTGTGCAA
CTAGCTACACCAACACTAAATTCCTTCCTGGAACTAAGTA
GAATGACATTGGACGGTAATATTGGCTCAACCAATTATAA
GACTTTGGAGGCGGGGCATATGTTTGCTCAATGGTACGTG
TGTAAATATTTCAAACTTGTTTTTTGGAATTCAGTTTAGT
GCCTCAGAAATCACACACTCCACCTTTAGGTCTCGATTGC
GAGACTTTCACAAGCTAGCAATAAAAAATATTAGCAGTTA
GCTAATTTGCGCTAATACTAGCAAGATGTTTAACACCTTC
AAAGATTCTAGTTTACCACATAAAGCATAACAAAGACATT
TATTAAAGATCTGGTAACCTAGTGAGTGTTAATTGCAAAC
CTGTTTCTATCACATTAAGGTTTTGGGGGAGATAATTTAA
AAGTGTTCCGCTCTCGATATATGTACATCATGTTCAGTTA
TTCATTTAATGTATATTTGAGTCTTTTGATTGACATTATG
GTTTAGTCAACAGTGTTGGCCCTGTAATCTGACAATATAA
GCACACTAAAAGCTGAAGAGAGCACTATTTTGTAGAATTG
GTTATATCCATGACTTTATAAAGTTCTCTGTGGCCTTTAC
CTTCCCTTTGTCGATTTCTATTATGGCTTTGTGTTCATTA
ACTAAATTATTTCCTTGCTCATTTGTCAGTGTTTTCAATG
ATTTGTCAATCTGCATGTCTGTACAGAGGAAAAAGTAAGG
TACGATAAATATGATTATTAGACAGGAACCAAGACATGTT
GTAACACTATGGGGTTTTTCAGAACGGTTTGGAAAAGGGC
TTTATTAATGGTGGATGAGAGGCCTTATATCTGGTTGAAA
TGCTGCATTTATGCTGTTTTGTCTGCTAGTACAGACTGAG
GATAATCAAATGTGCCAATTTCTTCGAGCTCCCTTTTGTT
GTCATTAATTTGTATGGGTTAAGGAAGTGTATTGGGGATA
TCATGCTGCATTCTTTTGAAGAAGACCAGATGTCCAGAGC
TGGATTTGTGAGACTGAAAGTGAGCTGGAATGCTGGACTG
TGATGGATTTTGAGAGAACCAGAGCTCCCTCTACAGTTGT
TATATTTTTTCAGTAGTTTTCTTTCAGGCCGTTAATACTT
AGTGTCTTTACTTAAGCTGAAAACTGTACCATCTATATAT
GATGGCATTAAAGGTTACCTTAGTTTCTTTGCTTTATTAC
TATACGAGCACAGTTGTGTACTCATTTACAGCACCACATC
TTCATACAGTTTCTACAGACAATGGTTGACAAAGCACTAA
AGCATAGTATAAAAGCTTTTCTTTCATTTCCAGGTATTCC
CTTTCAATCTTATTGTTTTTTCATTTAATGTCTGTACCAT
TCTGTACTGAAATAATATATATAACGACCTGCCTCACTTT
CCCTTGCAAAATAATTAACAGTTATATTTTTCAATAAAAG
AGAAAGCTGACAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations