Transcript

jmjd1cb-201

ID
ZDB-TSCRIPT-121213-821
Name
jmjd1cb-201
Previous Names
  • jmjd1cb-001
  • dkey-204n14.2-001
  • ottdart00000057685
  • si:dkey-204n14.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057685 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057685|OTTDARG00000040195|ZDB-GENE-121214-344 jmjd1cb|OTTDARP00000045196 DKEY-204N14.2-001 LG_none CR450773.12,CR354401.17 Danio rerio protein_coding NOVEL, 8751 bp
GTTCAGTTTCACGGAGCGCGAGAGCGACCATTCGCGGGTG
GAGGCTGAGAGAAATTTAAATCCCCCGGGTTGCGGTCGAC
ACGCAAAAAGGCGAAAAAATCACGGTTGTTTCTTTCTCTT
TGTTCAGAACGCACTTTGACGGCGTAAATGTGCGGTCGGT
AGGGTGCGAGCGTTGAAGTTTTCGAGGGTTTTTCGCCATG
GTGGTCGGGAAGCGGTTCCTGTGTGTGAGCGGAGAGGAGC
CGCTGGATCCCGCGCACATCGCGCACTGGTCATGGCGAGC
CGGAGTCATCCGAGCCGTCACTCACCGCGACCACGACAAT
CCCGAACTGACGGTTTACGTGGAGTTTGACGACCTGGAGT
GGGATAAGCGCGAGTGGGTCAAGGTCTACGAAGACTTCCA
GATCTTTCTGCTGGAACATCAGCTGGTTTGGGCCAAAAGA
AAAGAAGGTGCCCAGCTGCAGGGAACAAAAGCCAAGCAGA
TCCAGTGGCCAGCTCTGACGTTCAAGCCTCTGGTGGGGAA
GACAGTGTTCGGGTCCATCACAGCCATCGAGTTCTTCTCT
GACAGACACCTGGACTTCAATGCGGATGAAGGAGCCTGTC
AGCCCTATCAGGATGAAGTGGACAGTTTAAGTCCTGTTCT
CAGGGACTATCCACATCTCCATGAAGAAGTGAAAGCCTGG
GTGAAAGACCAAAAAGTTCAGGAAATTTTTATGCAAGGTC
CCTATTCATTGAATGGCTACCGCGTACGAGTTTACAGACA
GGACTCAGCCACCCAGTGGTTCACGGGCATCATCACCCAC
CACGATCTTTTCAGTCGCACTATGGTTGTCATGAATGACC
AGGTACTAGAGCCTCAGAACGTTGACCCCTTCATGGTACA
GATGACCTTTCTGGATGATGTGGTCCATTCTTTACTGAAA
GGAGAAAATATCGGTATCACGTCGCGACGCAGATCTCGCT
CTAGCCAGAACAGCAACACTGCCCATACCACAGGAGGGAG
ACCAAGCGGCTCTACAGGAATCACTCAGGGTCATTACACA
CGTGCCCAAGCCAACAGCCCGAGACCTGTGATGAATTCCT
CTGGCTCCACACCCAAACAGGCCTCTCAGGCCCAGCAGCA
ACAGCAGCAGCAGCAGCAACAACAAACCCAGCATGCTCAG
CAGCAGGTATCTCAGCAACACCACCAGCAGCAGCAGCAGC
AGCAGCAGCAGCAGCAGCAGCCACAGTCCTCACCAGGTCA
GCAACGCGGCTCACGATCTACACGTCGAAAGGGCTCCGAC
AGTAGTGTTCCAGACGATGAGAAGATCAAAGATGAAAAAT
CAGAGAGTGGAGGAAAAGACTCTTCTAAAAACAAAAGCAA
GCAAACAAACAAGAGGAGAAAAGCAGATGAAGAGGACAAG
AAGGGCAGTCTCAAGCGGCTCAAAACAGAGGCGTCTGACC
TCTCTGAGAGCAGCGACTCTGAGAACTCTAACAAGCGGAG
TGTAGACTCCTCATCGGAGCACAGTTCAGAGAATGAGCTC
AAATGCAAGAGCACTTCAAAAGTTCCAGAGGAGGAGGAGA
AGTCACAGGGATCCAAGTCCATGGATGAGTTGAGTGTCAT
CAATAGGCTGTCCCCCTGGGATGAGATGCAGGATAAAAGC
AGCAAGCCGGTAGCTTTGGAGGTGACTCAGCTGGCAGAGA
GTGAGCGGTTGGGAGAACGGAGATCTCCGCTCCCTCCTCT
GGCCTCCTGTACACAGAACCAAGCCTCGGGACCAATGGAG
GTCCAAAGCTGCATTGTGAAAAGCACTGTGAACACCCTCC
CCAAGGACCATTATGGCACAGGGATACCTCGGACGCACAC
ACCCAAGTGCGTGATTGATATCACAGAGGATTCCAACACG
CAGCCAAGTTCAAGAGAGAACTCTGAGGCTGTATCAGCCC
TATTGGCGTCACAGAAATGTGATGGCTACATCCCTGAATC
CAGACATTTGGTGCTAAACACCTCCCATTTAGAGTGCAGG
AGGCCGGATGGTGAGCAGCAGCAGAACTCTCGCAACATAG
GCAGTAAAATCGAATTCGCCCACTCTGAGGTCATAAGACC
GGTGACATCAGTTAGTGAGTCAGCAGCCCTGGGTGAGAGA
GGGAAGCTCCAGCAGCAGTACACTTCTATGGTTATTAAAA
ATGCCTCCGTTACGGAGGAGATCAGGAAAACCCATAAACC
CAGTCCTTCCCCTGACTTGCCCAAACCTAAATCAAACTCA
TCCCCTGACATCCTCAAGCCCAAGTGCAATCCTTCACCTG
ACATCTTAAAGTCAAAAGCTCACAGCATTCATGAATCCTG
CAAGCCCAAACCAAATACGTCCCCTGAGGTGTCCAAACAT
AAACAGCGGCATCCTGAAAACCTACCTACAACAGGCCGCT
TGGCACTCAAACCTGAGCCAGACATACCCCGATCTAGTTT
TAAACCTGTTCCAGCCCGTGGGGCACCATGCGAGTCCACA
AAAAGCCCACTTGTTGTTGACAAAAATGAGCATTTCACAG
TGTACCGGGACCCTGCATTGCTGCGGCCTGAATCAGACAG
CAACCACACCGCATACCTGCACCCGCACCTGCATCCACTA
CACGGTTCTTCTCACGCCACCTGTCTCACTCCCACCTCAC
ACCACCCAACTCATCTTCTCCCTTCTTCCTCCATGAGCCA
CTCTGTTCACCACCCACACCTGCTGCAAACCGTGCTGCCC
ACAATTCCACCAGGCTCCATCTTGAGCAGCCATCCCCGCC
TGGACTCTTCTGGACTTGGACACTTGGCCCTAGCCCACCA
TCATCCCCACCCGCCACAGCAGTACCTCCAGCAGCAGCCA
CCCCCTTCCCTGCTTGCCCAGACACATGGAGGTGCCTCAT
ACAACCAGCTTGGCCTCTACCCCATCATCTGGCAGTACCC
AAACGGTACCCACTCCTACCCACCTGGATACAAGTGGGTA
CATCCGGAGAATGCTGTCAATTCAGACTCCAGCCTGAGGA
GGAACACTACCAGCCCCTGGCTGCACCAGCCCACCCCTGT
AACCTCAGCAGATAGCATGGGGATTTTGAGCCATGTCCCG
GGAAGACCAGCCAGTGCAGATCCTCATCGATCCATTAAGA
TCAGCTCACACTCCAGCCCGCCGCTCTCCAAAACCCCCGG
AGAACTCCACAAAGAAGATCAGGAGAAGAGTGTGTTCGTG
GACCCCATGCGTAGCCTGGCCAGTGCTCACCTGAAGCAAG
AGCCAGACCGCAGCCGGACACCCACCAACAAGGAGCTGCA
CCGTCTCTACATGGAGTCCCCCCACAACAAGCAGCAGCTA
CCACCACGTATGCCTCAGGAGGGACCTGACCGCACCAGCA
AATACAAGGAGGAGAACCGCCGCATCCTACTGGAGAGCAT
TGAAATGGCCCCCTTCACCGCCAAGATTCGTGCTGGGGAG
GCTGAGCATGAGCCCTTTCCACGTCCTATTTCCTCCCAGC
CCAAAAGCCACGAGAAAGAGACAGAGCACTCTATGGCTGA
TCTGTACAAGTACAAACACTCTGTATCTCAGTCTCTCCCT
CAAACCAACTACTTTACTACCCTGTCAAATAGTGTTGTTA
ATGAACCACCACGACTTTTTCAATCCAAAGATCTTAATCC
GTACTTTGACAAGGCACCCCCGACCTCTAGCCCCCTGTCT
TTGGGCTCGTATAACCCTAGTCATACCAAGTCTTTGTCCA
AGCCTCCACCTCTCATTAAGCATCAGCCAGAGGGAGAGGG
ACTGATGGGCAAGATCTCTGAACAGCTCAGTCAACAAGCA
CCCATACACTCACTCGGTACCTCAGTGGTGACAGTCAGCG
ATCGCTGTAGCCCTGCCATCTCTCCCTCCAATCAGCCTAA
GGGTATGCCAGCCTTGCGTAGAGCGCCAGTCTTTACTCCG
CCCACCCAGCAGGCGCTTGACCGCAAGGAGGGGGGCTACG
GTCGACTTTCCCCACCTACACTCACCCCCATCCAGCCCGT
GAGTCAGGCAGGGAAAGTGTCAGAACAACAGAAGCCGCCC
ACCCTGCTCCCAGAGCTCAGGGATGAAAAAAGCGGAGCCG
AGCTGGGCTCGGCAGACTCCTGGCGGACTGGCGGGGAAGC
AAAGAGCCATGAGAAAGTGGCCTGGCATTCAGAGAATAGC
CAAGGGAAGCCACAGGCAGCCATGGCATCTGTTATTGTCC
GCCCTTCTACTTGCATAAAATACGACGGCTCGCCAGGTCC
TAAGATGGCCTCCAAAGAGCAACTTGGTGGCAGATTGTTT
CCTGGACGCACTCAGGCGGACTGCCTGAAAGTGGCAGAGA
ACAGGGAATCTGGGAGAGTCATCCTACCAAACACAAATTT
GGAGGATCCCAGTGATCAGTACAACAAAAACCTGATTAGA
GCATCACCGGGTGTCATTCCCAGCTCAGTGGCAGTTGTGG
CCAATTCTGTGTGCAGCACTAAGACTAATGAAGCCATTGC
TGCTGCCAGCGGCACATTTAGCACGCAGAGCCACAATGGA
CCAGATATGTCCTTTTCCATCTCTGCCACTAGTGTTAGTA
AGAGACTGGAGAGCTCTCCTTCCAATAGCCGTCCTCCCTC
TATTGTTGAGTCACAGAAGGGAGGTTCGAGAACCACCTCC
CCTAGTGGCCTGCCTCAGGCCTGCTCCGCTGGCACCCCAC
AGGCCTACTCAAGAAATTTTGTTCACCTAAAGAAGGCCAA
AGCCGCTCTGGCTGCTGCACAGTCTCGTGGCTCCAGCAGC
GCTTCTGAAAGTGAGAGCGGTAGCGTCAGATCCTCTCAGG
ACTCACCCACAATTGCCCAGGAGAATTCCACGCCCAGCAA
TCCTCCCAGCAAAGCCAGCCCGTTGCCCAATGGACAGGCA
GCGCAGGTGTGCCAGTCTAACTACCACAAACTCAAGAAAG
CCTGGCTCACACGACACTCAGAGGAGGACAAAAACACAAA
CAAACCTGAAAAGGGTGGCAATGCCATTTCTGAGCTAATT
AAGCCATGTTCTGTCAACCTGATTGCCCCCGCATCCGGCG
ATGTTGATATGGGCAAGGACAGCAAAGGACAAGAGGACAA
GCTGTCCCAGGAGGACAGAAAGACACGCCGTACCCCCAAG
CGTCCATATGAATCGTGTTCAGAGAGTGGCGATGACTCAG
ACTCCAGCGAGAGCAAGCTGGAGCAAAGGACTAAACGGCA
ACCCAAGCCCACTTACAAAAAGAAGCAGAACGACATGCAG
AAAAGGAAGGGAGACAATGAGAAGGAGGAGGACGAGGTTA
AACCCAATGGTATTTTCCGGAGTGCCAAGGAAAAAACCAA
ACTCAAGCTGGCCAGTACTAATGGCATTCCCCGGTCAGTG
CTGAAGGATTGGAGAAAGGTAAAGAAGTTAAAGCAGACGG
GTGAGTCCTTCCTACAGGATGATTCATGCACAGAAATTGG
ACCCAACTTACAGAAGTGCAGAGAGTGCCGCTCCATCCGC
ACCAAGAAGGGAGAAGAACCTACTCACTCACCTGTCTTCT
GCCGCTTCTACCACTTCCGCCGCCTCTCGTACAGTAAGAA
CGGAGTGATCCGGATCGATGGCTTCTCCTCTCCTGATCAA
TATGATGAAGAGGCTCACAGTATCTGGGCGTCAGACGCTT
ATGAAGAAAACAACCTGGACCTGGAAACCTCCAAATACAT
CCTCAGCTACATTGGAGACAAATTCTGTCAGCTGGTTATG
ACTGAGAATACAGCGACTACGTGGATAAAGAAAGATGCCA
AGATCGCCTGGAAGAGAGCGGTGCGCGGGGTGAGAGAGAG
CTGCGACGCATGTGAAGCCACATTGTTTAACATTCACTGG
GTCTGCCAAAAATGTGGATTTGTGGTGTGTTTGGACTGTT
ATAAGGCCAAGGAGAGGAAGAGCTCCAAAGATAAAGAGCT
GTACGCCTGGTTGAAGTGTGTCAAGGGACAGCCTCATGAT
CACAAGCACCTGATGCCAACACAGATCATTCCTGGAACTG
TTCTAACGGACCTGGTGAGCGCTATGCACATGCTCAGGGA
GAAATACAGCATTAAATCACACTGCTCGTGTGCTGGGAAG
CAGAACACCCTCTTCAACAAGCTGCCCTCAACTAATGGCG
TCTCCCAGGTGTTACAGAACGTGCTCAATCACAGCAACAA
GATCTCTCTGTGTAAGCCCGAGGGCGGCCAGCAGAACTCT
CTGAAGGTGGAAGCCAACGGTGGGAGCAGTCCCGCTAGCG
ACACCAGCACCGACAGCAAGTTCACTCCACCCGAGTCCCA
GTCGCCTCTGCACTTCCTGGCTGATCTGGCCGAGCAGAAG
TCCCGTGAGGAAAAGAAGGAAAACAAGGAGTCAGGTGTAG
GGAAGATGAAGGAAGAGAAAGATCAGTCAGATGCTTTGGA
GTCTCTACACAGCAAAGCATCGTCCCTGGAGCAGGGATCA
ACCCTACGAGACCTGCTCACCACCACCGCAGGCAAGCTGC
GCCTGGGCTCTACTGATGCTGGCATCGCATTCGCTCCGGT
GTACTCCAATGCCTCGCAGATTGTCAAGAGTGGCCGCAGC
ATGCCCAACATCCTGGATGACATCATCGCCTCTGTGGTGG
AGAACAAGATCCCGGCAGGCCGTGGCACGAAGTTAAACCT
GAAGCACGAGCCTCTGGAGGAGCCCAAAGTCGAGAGAAAG
AAAGCAGTGGAAGAGCCACCCAAACTGTACGCTGACATCC
CCCATTGCTGGCTATACGAGCGCAAGCTGCTCTGGCTCAA
AGACCACCGCAACAGCGGCAACTGGAAACTCTTCAGGGAG
TGCTGGAGACAAGGACAGCCTGTACTAGTCTCTGGGGTGC
ACCGAAGGCTCAACGCCAGCTTGTGGAAAGCAGAGTCCTT
CAACCAAGAGTTTGCTGACCACCAGGGGGACCTCTTGAAC
TGCAAGGATGGAGTAATGTCCAACTCAGGTGTCAAAGAAT
TCTGGGACGGCTTTGAAGATCTCACAAAGCGACCCAAGGC
TAAAGATGGAGAAACCGTTGTGTATCGATTGAAGGACTGG
CCTTCAGGGGAAGAGTTTATGGCTTTGATGCCCTCCAGGT
ATGATGATTTGATGAAGAACCTCCCCATGCCTGAATATTC
AGACCCGGAGGGAAACCTCAACCTGGCCTCCCATCTGCCC
ACCTTCTTTGTGCGGCCGGATCTGGGCCCTCGCCTCTGCT
GCGCATATGGTGTGGCAGCATCTCAGGAGCAGGATTTCGG
CACTGCTAACCTGCACATGGAGGTGTCTGACGTGATCAGC
GTGCTGGTTTACGTCGGAGTGGCAAAAGGGAATGGCGTCT
TGTCCAAAACAGGAGTGCTGAAGAGGCTGGAGGAGGAAGA
TCTGGATGACAACGTCAAGAAAAGATTAAAGGACTCGAGC
GAGACTCCGGGAGCCTTGTGGCACATCTACACCAGCAAAG
ACGGCGAGAAGATTAAAGAGTTCCTGCACAAGGTGGCGAA
AGAGCAGGGTGTGGAGATCGCAGCAGATCACGACCCCATC
CGTGATTCCAGCTACTACTTGAGCCGAAAGCTACGTCAGC
GGCTGCTGGATGAACATGGCATTCAGGGCTGGACTGTGGT
GCAGTTTCTGGGTGATTCAGTCCTGATCCCGGCAGGAGCT
CTGCACCAGGTGCAGAATCTTCACAGCTGCATTCAGGTGA
TCAATGACTTCGTGTCTCCAGAGCACGTGGGGCATTCCTT
TCACTTAACACAAGAACTCAGATCCTCCAAAGAGGAGATG
AACTACGAAGATAAGCTACAGGTCAAGAACATCTTCTACC
ACTGCGTGAAGGACGCCGTGGGCACATTGAAGAGGAGCTG
TGCTGAGGAGGAAGAGGAGAGCAACTCATGACAGCCGTCC
ACACGCACGCACACACCGCCAACCTCCAGTGCCAAGTAGA
CCACACCAACACCACCCGTCTGACAGCTAGCGTTCGTCTG
TCCGTTTGCTTTCCTTTCCCTCTCCTTCTTTCATACTGTA
TAGTTTCAGTATTTATTTTCAGGCGTTCTGTTCTCGATCA
AATGTAAATGTGACTTGTACAGTTTGCTAATGGATTTCAC
TACTTTTGGAGACTTGGAGTTACTGTGAGAGAGATCCACC
ATCTCGTGTCCTCATGCCATATCTTTTGAGAAAAACAAAA
CAAAACAAGAACTGCCAAACAATTGTAAACATTGTACAGT
TCTGTTATTATGTAAAGAAAGACTTAATAACACACGTCAG
CATTTTATTAAGAAGTATTCACTGTAAAATGGAGACATTT
GCAAAAAAAAAGAAAAAAGAAAGAAAAAAGTTGTAATTTA
TTTAAGAAAATTGTCGTTTTTTCTGCTTTTTATGTTCAGA
TTTACTATGGTGAACTTTTGAAGTTCGATGGAAAAAGGAA
AATCGTACTATGCTGTGTAAATATATACATATATACATTC
ACTGATGTATTTTTTTAAACATGGCTTGCTTCAATTTCAA
ATTTTAAAGTGCAAGTGTTACATGCTTTGTACATTGAAGT
TCAAAAGGGTTTTACATTTTCCATTAAAATGGATTTATCA
AATATCCGCCTGCCGTTTGCCTTATTGATAAGCCGGAGGT
CAGAAATTCAAATCTGCAGGGGTTTCTTTGGCTAACAATG
AGGGTTTCAAAATAAATAATAATTGGACATGTTAACGCTT
CAGATATGTATATTCATCATCATTTGCATGACTAATTTAC
AGCAGGGGTTCCCAAACCTTTCAACCTGCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations