Community Action Needed: Please respond to the NIH RFI
Transcript

myh7ba-201

ID
ZDB-TSCRIPT-121213-819
Name
myh7ba-201
Previous Names
  • myh7ba-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057671 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057671|OTTDARG00000040185|ZDB-GENE-100914-2 myh7ba|OTTDARP00000045185 myh7ba-001 LG_ CR555298.10 Danio rerio protein_coding KNOWN, 6041 bp
ATCATCATGTCGCGAATGTTGGATATGAAGGAGTTTGGAG
AAGCTGCTCCGTTTCTGCGCAAATCCGACCTGGAGCTGCT
GGCTGCGCAAACTGTGGCGTTTGATGGAAAGAAACGCGCT
TGGATACCAGATGACAAGGACGCGTATATTGAGGTGGAAA
TCAAGCAGATTGATGGTGACAGAGTCGAAGTTGAAACGAA
GGATGGAAAGTGCTTAACTGTCAAGGAAGATGACATTCAA
CAGATGAACCCGCCAAAGTTTGACCTGATAGAGGACATGG
CCATGCTCACACACCTGAACGAAGCGTCGGTGCTCTTCAA
TCTGCGGAGGCGATACAGCAGTTGGATGATTTATACGTAC
TCTGGGCTCTTCTGTGTGACCGTGAACCCATATAAATGGC
TCCCCGTCTACACTGCCCCTGTAGTGGCTGCCTACAAAGG
CAAACGCCGCTCGGAGGCTCCACCTCACATCTACTCCATT
GCTGACAATGCCTACAATGACATGTTACGCAATCGTGAGA
ATCAGTCCATGCTAATCACCGGAGAATCTGGTGCTGGCAA
AACAGTAAACACGAAACGTGTAATTCAGTATTTTGCCATA
GTAGCGGCCCTGGGTGAGGCAGCGGCTAAAAAAGGAGCCC
CTGCTACTAAAACAGGGGGAACTTTAGAGGATCAGATCAT
TGAAGCTAATCCTGCAATGGAGGCTTTTGGAAATGCCAAG
ACACTGAGGAACGACAACTCGTCCCGTTTTGGTAAGTTCA
TCAGGATCCATTTTGGACCAACAGGGAAACTGGCCTCTGC
TGACATTGACATATATCTTCTGGAAAAATCCAGAGTGATA
TTTCAGCAACCTGGAGAGCGAAGTTACCACATCTACTACC
AGATCATGTCACAAAAGAAGCCTGAACTTCTTGACATGCT
ACTGGTCTCTTCAAACCCATATGACTACCACTTTTGCTCC
CAAGGAGTGACAACGGTGGAAAATATGGATGATGGACAGG
AACTTATGGCTACTGATCATGCCATGGACATCCTGGGCTT
CACTCCAGAAGAAAAGTACGGCTGCTATAAAATAGTAGGG
GCCATCATGCACTTCGGGAACATGAAATTCAAACAGAAGC
AGAGGGAGGAGCAGGCAGAGGCTGATGGCACTGAAAGTGC
TGATAAGGCTTCCTACCTGATGGGCGTTAGCTCAGCAGAC
CTTATAAAAGGTCTTCTGCACCCTAGAGTGAAGGTGGGCA
ATGAGTATGTGGTTAAAGGACAGAATGTGGAACAGGTTAA
CTATGCTGTTGGAGCTCTGGCCAAAGCCACTTACGACCGC
ATGTTCAAGTGGTTGGTGGGGCGTATAAATAGGACGCTCT
ACACTGCTCTGCCACGCCAGTTCTTTATCGGAGTGCTGGA
CATCGCCGGCTTTGAGATCTTTGAGCTCAACAGCTTCGAG
CAGCTCTGCATCAACTTCACCAATGAAAAACTGCAACAGT
TTTTCAACCATCACATGTTCATCCTGGAACAAGAGGAGTA
CAAACGGGAAGGCATCGAGTGGACCTTTATTGACTTTGGG
CTTGACCTCCAAGCCTGCATTGACCTTATTGAAAAGCCCT
TAGGAATTATGTCCATCCTTGAAGAGGAGTGCATGTTCCC
TAAAGCTACTGACAACAGCTTCAAGGCTAAGCTGTTTGAC
AATCACCTTGGAAAGTCGGCCAACTTCCAAAAGCCAAGGC
CTGACAAGAAGAGAAAGTATGAAGCTCATTTTGAGCTGGT
GCACTATGCAGGAGTGGTGCCATACAATATCATCGGTTGG
CTAGACAAAAACAAAGACCCTCTGAACGAAACAGTGGTCA
TCTGTTTCCAGAAATCATCCAACAAGCTTCTTGCTAGTCT
GTATGAGAAATACGTCAGCTCTGACTCGGCTTCTGACCCA
AAAACAGGGGGCAAGGAAAAGAGAAAAAAGGCTGCCTCCT
TCCAGACAGTGTCACAGCTGCACAAGGAAAATCTCAACAA
GCTGATGACAAATTTACGAAGCACTCAGCCACATTTTGTC
CGCTGCATCATTCCCAATGAAACCAAAACACCAGGGATCA
TGGATTCTTTCATGGTTCTGCATCAATTGCGCTGTAATGG
AGTCCTGGAAGGCATACGCATTTGCAGGAAGGGATTTCCA
AACAGAATGCTTTATGCTGAATTCAAACAACGGTATCGCA
TTCTGAATCCTCACGCTATTCCCGATGACAAGTTTGTGGA
TAGCAGGAAGGCTGCGGAGAAACTTCTGGCTTCACTGGAT
ATTGACCACAATCAATATAGATTTGGACATACTAAGGTGT
TCTTTAAGGCTGGTCTGCTGGGACAGCTGGAGGAGATGAG
AGACGAGCGTCTGGCTAAAATTCTCACTCTGCTGCAGGCC
GCCAGCCGCGGCAAGATCATGAGGATGGAGCTGAACAAGA
TGACGCAGAGGAAGGAGGCTCTGATGATCATTCAGTGGAA
TATTCGGGCCTTCAACATTGTGAAGAACTGGCCATGGATG
AAACTGTTCTTCAAAATCAAACCCCTGCTGAGGAGCGCAG
CCACAGAAAAAGAGCTGGCCGCTCTGAAAGAGGAGTTCCT
GAAGCTAAAGGAAGCACTAGAGAAATCTGAGGCCAAACGT
AAGGAACTGGAGGAGAAACAGGTCAGCCTGATCCAAGAGA
AGAATGACCTTTCTCTGCAGCTTCAGGCAGAACAAGATAA
CCTTGCAGATGCAGAGGACCGCTGTGATCTGCTCATTAAG
ACCAAGATCCAACTTGAAGCCAAAGTAAAGGAGATGACCG
AACGCCTGGAAGACGAAGAGGAGATGAATGCTACAGTTCT
GGCAAAGAAGCGTAAACTGGAAGATGAGTGCGCCGAGCTG
AAAAAAGACATCGATGATCTGGAGATAACCTTGGCCAAGG
TGGAGAAGGAGAAGCATGCCACTGAAAACAAGGTGAAGAA
TCTGATAGAAGAGATGGCAGCTTTGGATGAAACTATACTG
AAGCTCACCAAAGAGAAAAAAGCCCTACAGGAGAGTCACC
AGCAGACCTTGGACGACTTGCAGACAGAGGAAGACAAAGT
CAATACTCTGACTAAGGCCAAAGCCAAGTTGGAGCAGCAA
GTTGATGATTTGGAGGGCTCCTTAGAACAGGAAAAGAAAT
TGCGAATGGATCTGGAACGTTCAAAACGCAAGCTGGAGGG
CGATCTGAAGCTGTCAATGGAGTCTGTCATGGACCTCGAA
AATGACAAGCAGCAATTAGAGGAAAAGCTAAAGAAGAAAG
ATTTTGAAATGAACCAGATCAGTTCAAAAATCGAAGATGA
CCAAGTGCTAATCATCCAGCTTCAAAAGAAGATCAAGGAA
CTGCAAGCTCGTATTGAGGAGCTTGAAGAGGAAATGGAAG
CAGAGCGCTCTACCCGAGCCAAAATGGAGAAACATCGAAG
CGATTCGTCCAAAGAGCTTGAAGAGCTCAGTGAGCGTCTC
GAAGAAGCCGGAGGAGCCACATCGGCCCAAATTGAGATGA
ATAAGAAACGAGAGGCCGACTTTTTAAAACTACGCCGTGA
CCTTGAGGAGGCCATACTGCACCATGAGGCCATGACTGCC
GCATTGCGCAAAAAGCATGCAGACAGCGTGGTTGAACTGA
GTGAGCAGATTGACAGCCTTCAGCGAGTCAAACAGAAGCT
GGAGAAGGAGAGAAGTGAGGCCAAGATGGAGGCCGATGAC
CTCACCTCCAATTTAGAGCAGCTGGCAAAGGGCAAGGCTA
CTGCTGAGAAAACCTGTCGCCTTTATGAAGACCAGATGAA
CGAGTCCAAAGCCAAAGTGGAGGAGCTCCAGAGGCAGCTC
AGTGACACCAACACGCAGCGAGCCCGTGCTCAGGCTGAAA
GCGCTGAGCTTGGCAGAAAGCTGGAGGAGCGTGAAGCTCT
GGTGTCTCAACTGCAGCGCAGCAAAAACACCTTCAGCCAA
AACATTGAGGAGCTGAAGAAACAGCTAGAAGAAGAGAGCA
AATCAAAGAATGCTTTGACTCATGCCCTACAATCCTCCAG
ACATGACTGTGATCTGCTGAGAGAGCAATATGACGAAGAA
CAAGAGGGTAAATCTGAGCTTCAGCGCGCACTGTCCAAAG
CTAATGCTGAGGTTGCCCAGTGGAGGACCAAATATGAGAC
AGACGCCATTCAGAAGACAGAGGAACTCGAAGAAGCAAAG
AAGAAGTTGGCCACACGCCTCCAAGAGTCTGAGGAACAAG
TTGAAGCCTCAAACGCCAAGTGTTCCTCATTAGAAAAGAC
CAAACATCGGCTGCAGTCTGAGATTGAGGATCTGGTATTA
GATCTGGAGCGCTCGAACGCTGCCGCCACTGCACTGGACA
AGAAGCAGAGGCAATTTGACAAGATTCTGGCTGAATGGAG
GCATAAGTACGAGGAGTGCCAGTCTGAGCTGGAATCATCT
CAGAAAGAGTCTCGTAATCTGAGCACGGAGCTGTTCAAAC
TCAAGAACTCATACGAGGAGGCTCTCGACCATCTGGAAAG
CATCAAACGGGAGAGTAAAAATCTACAGGAGGAGATTTCC
GACCTCAATGACCAGATTAGCCAGGGCGGCAAGACCATTC
ATGAGCTGGAGAAGATCAAGAAGGGCTTGGACTTGGAGAA
GACGGAAATTCAAGCAGCTCTTGAGGAAGCTGAAGGCACT
CTGGAGCATGAAGAGAGCAAGACTCTACGTATACAGCTGG
AGCTCAACCAGATCAAAGCAGACACTGACCGGAAGCTGGC
AGAGAAAGATGAGGAAATTGACAATCTCCGCCGTAACCAT
CAGCGTGCCCTAGAGTCCATGCAAGCCACGCTGGATGCAG
AAGCAAAATCTCGTAGTGAAGCCATTAGGGTGAAAAAGAA
GATGGAGAATGACCTGAATGAAATGGAGGTTCAGTTGAAT
CATGCAAATTGGTTGGCCACTGAGTCCCAGAAAATGGTCC
GAAACCTACAGACACAGATTAAGGACCTTCAGATGGAGCT
GGATGAGACAGTTCACCAGAATGAAGAACTGAAGGAGCAG
TCTGCCGTGACTGAACGCAGGAACAACCTCTTGACTGCTG
AGGTGGAAGAGCTGAGATGCCAGCTGGAGCAGAACGACCG
AGCACGAAAACTGGCCGAGTTTGAGCTTCTGGAAACCACA
GAGAGAGTCAACCTGCTGCATTCACAGAACACTTCAATGC
TCAATCAAAAGAAGAAGTTGGAGAACGATCTCGCCACACT
TTCTAGTGAGGTGGACGATGCTGTGCAGGAATGTCGAAAC
GCTGAAGAGAAAGCCAAAAAAGCCATCACTGATGCAGCCA
TGATGGCGGAAGAGCTCAAGAAAGAGCAGGACACCAGCGC
TCATCTAGAACGCATGAAGAAGAACATGGAGCAGACCATC
AAAGATCTGCAGCTGCGTCTGGATGAGGCTGAACAGATCG
CTCTGAAAGGAGGCAAGAAACAAATCCAGAAACTGGAAAG
CAAGGTGAGAGACCTGGAGAGTGAACTGGAATCTGAGCAG
AAAAAAAGCAATGAACTCCAGAAGGGAATTCGCAAATATG
AGCGAAGGATCAAGGAGCTCACCTACCAGACTGAAGAGGA
CAGAAAGAACATTGCTCGCCTCCAGGAGCTCATAGACAAG
CTACAAGCCAAAGTTAAAACCTACAAGAGACAAGCTGAAG
ATGCTGAGGAACAAGCTAATTCCAACTTGACCAAGTACAA
GAAGATCCAGCATGAGCTGGACGACGCTGAGGAACGAGCA
GATATCGCAGAGTCTCAAGTGAATAAACTACGGACCCGCT
CCAGAGACTCTGGCAGTAAGACTACTCCTAAGCTTGCAGA
GTGAAGAGGAAGGGGCCATTAACTGTGGCCACAAAACCTA
TGAGCAAGTTAAAGAAATCTGTATGTAGAGCATTAGAAAT
GGGTATATTGTATTTAACTGTACTACTAATATATACTGCA
ATCAGTGGTGGAAAGAGTACTGAAAAATGATACTCATGTA
AAAGTACCATTAACTTGCCCCAAAATATAGTGCAAATTTG
A

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations