Transcript

myh7ba-002

ID
ZDB-TSCRIPT-121213-198
Name
myh7ba-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057672 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057672|OTTDARG00000040185|ZDB-GENE-100914-2 myh7ba|no_translation myh7ba-002 LG_ CR555298.10 Danio rerio protein_coding KNOWN, 819 bp
ACCAGATGACAAGGACGCGTATATTGAGGTGGAAATCAAG
CAGATTGATGGTGACAGAGTCGAAGTTGAAACGAAGGATG
GAAAGTGCTTAACTGTCAAGGAAGATGACATTCAACAGAT
GAACCCGCCAAAGTTTGACCTGATAGAGGACATGGCCATG
CTCACACACCTGAACGAAGCGTCGGTGCTCTTCAATCTGC
GGAGGCGATACAGCAGTTGGATGATTTATACGTACTCTGG
GCTCTTCTGTGTGACCGTGAACCCATATAAATGGCTCCCC
GTCTACACTGCCCCTGTAGTGGCTGCCTACAAAGGCAAAC
GCCGCTCGGAGGCTCCACCTCACATCTACTCCATTGCTGA
CAATGCCTACAATGACATGTTACGCAATCGTGAGAATCAG
TCCATGCTAATCACGTAAGTTTGAAAAATACCCATATACA
CATTCTGCATTGCTGTTGCGTTGAGACATTTTCAGAGTGG
AAAAAACAAAAAATAAATTCATAAGTTTTTGCAGTTGCGA
TATTGTATTTTCTTAAAAGAAGATTTTGTTGCTCTGTTTT
TTTTTAAGCTGTGGTATTTTCCTTTTTTAATCTTGTTTTT
CAAATGTCTCATCACTGAACCATTTCTTGATACTCCTAGC
GGAGAATCTGGTGCTGGCAAAACAGTAAACACGAAACGTG
TAATTCAGTATTTTGCCATAGTAGCGGCCCTGGGTGAGGC
AGCGGCTAAAAAAGGAGTAAGACACAAAATGCTCTCTCGG
TTTCTATCATATATCATCCCCCTTTTCTCGTTCAGTATGC
TTTTTTACCTTTCATGCTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations