Transcript

bcl11ba-003

ID
ZDB-TSCRIPT-120702-44
Name
bcl11ba-003
Previous Names
  • dkey-238i13.1-003
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055376 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055376|OTTDARG00000019355|ZDB-GENE-061207-62 bcl11ba|no_translation DKEY-238I13.1-003 LG_none CT027566.8,CR382377.10 Danio rerio protein_coding KNOWN, 543 bp
TTGGACATACCCCCAGCCCCCCTAATCCCATCTGAAAATG
TCTACTCCCAGTGGCTGGTGGGCTATGCAGCATCCCGCCA
CTTCATCAAAGATCCTTTCCTTGGCTTCACCGACTCCAGA
CAATCTCCATTCGCCACCTCCTCGGAACACTCCTCCGAGA
ACGGAAGCTTGCGATTCTCTACGCCGCCAGGGGACCTGCT
GGACGGGGGCCTCTCCGGCCGCAGTGGTACTGCTAGCGGA
GGCAGCACCCCGCACCTGGGTGGGGGGCCAGGACCAGGCC
GGCCTAGCTCGAAAGAGAGCCGGAGGAGTGACACCTGTGA
GTACTGTGGGAAGGTGTTCAAGAACTGTAGCAATCTGACA
GTGCACAGACGCAGCCACACAGGCGAGAGGCCCTACAAGT
GTGAGCTTTGTAACTACGCCTGCGCCCAGAGCAGCAAGCT
CACCCGCCACATGAAGACACACGGCCAGCTCGGACTTCCT
GTGATGTGTAGTTGAACGCATTCTCAGAAGTAGCAACACG
CTTACAGAATGCACAGCTGAATT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations