Transcript

baxa-003

ID
ZDB-TSCRIPT-120213-992
Name
baxa-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000053697 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000053697|OTTDARG00000037551|ZDB-GENE-000511-6 baxa|no_translation baxa-003 LG_ CR388062.19 Danio rerio protein_coding KNOWN, 734 bp
AGTTTTCATCATACTGCTGACATGGAAGCGCTGTTGGATT
ACGTTGTTCGTATTGGCAGTGGCAATGATCAGACACTTGA
TGCAGGATCTGCAGTTCTCTTTAACTTCATCTTTGAATGG
CTTCATCAACACTTAGACAAAGAAGCTGAAATAACCTGTT
GGTTACAAAATAATTTGGGTATTGTTGAGAAAAGTGACCC
CAGCCATAAAGATGCAATCGAGTGTATGGTGAGGATTGCA
AATGAAATGGAAGGAAATGAAGAACTACAAGGGATGTTAA
ATAGCGCTCTCTTAAATCCAACTCTAGAACACTACATCCT
TGTGGTCAATGGGACCTTCTCTGATGTGACATTAAGCTGG
GGTAGTGTTGTGGCACTTTTTTATGTTGCATGTCGGTTTG
TTGTTAAGGTGAAAACATATCCATGTATCATCTCATATTA
AGGGTGCTTTCACACTTGGTTCAATTGCCTGGACTGTACC
CAAGTTCGATTGTCCCCCCTTGCCACCTTTTTAATTGGTT
TGTGTTCACACTGTCTCTTTCCTTCTGAACCCTGGTACAC
TTGCTTCATCGAGCTGCTGTTTTGTTTACGGCTGTTGCAA
GGTGACGTCACGAAAGCAAAGCATGACATCGCAGTCATTC
TGCTTTTACTGAATCTTTTGGTTTTACACATACAGAAAGC
GACACACGTCCACGTTTAGAACATCACACAGTGTCTGCAG
AAGCTGTTTTTGGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations