Transcript

cdk12-202

ID
ZDB-TSCRIPT-120213-84
Name
cdk12-202
Previous Names
  • cdk12-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000053178 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000053178|OTTDARG00000029316|ZDB-GENE-081104-294 cdk12|OTTDARP00000041834 cdk12-003 LG_none CU658288.8,CU694223.9 Danio rerio protein_coding KNOWN, 579 bp
TCCCGGACCCCAGCCGCCCCCTCCACCCCTGAGCCTGACA
CTGCGCAGCAGCTCGAACTGCTCAGCCAGCTCTCCACCCT
AATCCAGTCCTCTAACGTCCCACAGCCGGCAGATGCCCCG
CAGGAAGACCAGGCCGGCATCCTGGCGCTCCTATTGGAGC
AGCTGATCAAGGCGCCGGCGGCAGAGGCGGAGCGGGCCGA
TGAGAGCAACGGGGTTCCACCAGAGGAGGGCGCTGCACAT
GCCGGCTCCGCTTCTGTCACGAGTGCCGATAGCGAGGGAA
TAAAATGCCCAGAGCGCCGTCTGCGTGCCACCCGTTCACA
GCAGACTTTATGTATGTGTGTGTGTGTGTGCAGAAATGAG
CTCGCAGACAGGAAGCGGGAGTTCTTCATCTGTTGGCACA
CACTGCAAGTCCTCGACAGATGGTTACGGTGTTTGCGTTC
AAATGTCACTCTTTTAAAGCCAGATTAAACAGAAATAAAG
AGCCGTTTTGGACACATCTCTACTTATGTGTGTCTGTTCT
AGTACACTCACTAAAACAACACTTACCTGGAGAATTAAGA
TGAGCAGCGTTTGCGACCG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations