Transcript

cdk12-201

ID
ZDB-TSCRIPT-090929-20373
Name
cdk12-201
Previous Names
  • cdk12-001
  • si:ch73-79d13.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000040197 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000040197|OTTDARG00000029316|ZDB-GENE-081104-294 cdk12|OTTDARP00000032131 cdk12-001 LG_none CU658288.8,CU694223.9 Danio rerio protein_coding KNOWN, 5821 bp
TTTGGCTGTAATGGATGAAGTGAATTCTCTCTGAGTTAAG
GGCCGTGGAGGGTTTTATATCCACGAACATCGCCCAATTT
CTGGGTCTGGTTTCTTCCCAGAGCCGCTTAAGTGAACTGG
AATCAATTTGAACACATAAATATGCGATCATTTCCGATGA
ACATGAAACTGCAGAGAGTTTACACTGAACATTAAAGCGA
ATATGTGAACAAGAAGCAAGCGGGTCAAGTTTTATTTTCA
GTTATGTGGGACAATATCCCTACACAGCGAGCTTTACTGC
TTCAGAGCTCAGAAACCGTGTGCAAGGAGAGCCACACGTC
TGTTTAGACTTTGATATCGAGCAAGGATAAACAGTCTAAA
ACAAGGACAGCCTGTATTTTTCTTCTTTCTTTTTGTCTTT
TCGGGGGACGCTAGCTTGGCTAAAGCTAGCCGAGAAGCGC
GAGCGCAATGCGCTCCCTGAGGCACCCTGGAAACCGCCAG
TGATGCCATCCTGAAGGACATATCGTTAAAAATCGTTTTT
GTTTTGGTCTTTGCACTCTTGGATTTATTTTGACGCGATT
TGAGGAGGCCACGGGACCGGGGATGAGTTGTGGATAACCT
ATGCGCATTCAATCGCGTGCGCATCTTTGTTTTGCTTCCC
CATTACTCCTCCATCTGGCAAGATTTCACACTTTTACTCA
ACACTGAGCGATTTGTGCTGTTCATGTGCTGTCTTGACCG
CATAGGTCCGCGTCTCCGGAGGACAGAGGTATGCCTGGAT
CAGACCGCCTGCATGGGACCAAGAGGAAGGCTGAATCGCT
GTACCACCAACAGCTGCAGGCGGCCGCCGGGGATGGTCAG
CCGCTGCAGCACGCGGGCTCCGGTAGGCATCTTACCAAGA
CGACGAGCTCCTCGTCCACTTCTTCTAAGCACAAACGAAA
CAAGTCCAAACACGAGGCCGAAACTGGCGCGTTGTGCGTT
GTCTCCGCGCGTCCAGCAGCGGGCGCTATCAAGCCTCTGG
TGGAGTACGACGACATCAGCTCGGATTCGGACACGTTCCT
TGACTCCCCCGCCACCGGGAACCCGGTGGACACCAGAGAC
GCCGAACAGCTAGATCTGTCGGACTACGGTGAGGTGGTGG
CGGGGGTCGCCAAAGAGAACCGGACTCATAAACGCAAGCG
CTCCCGGAAGAAATCCAAAGACCGGCATCGGGTCAGGGAG
TCTGCGGAAAGACCAGTAGGGGCCAAAAAGAGCATCAAGG
ACCGGGAGAGGGTGAGCAAAGAGAGCCGAAAGAAGGTTAA
GGAGAGGGCTAGTCCAGTCGCGTGCCTTGCTGCTTCATCA
TCCAGACGCTCCGGTGAGACCGGTGCCAAAAAGCTCGGCG
GCGGCGAATCGGTGTCCTCCAGCGCGGTGCAGTCAGCTGT
CAGCCTGGGCAGCAGCGCCTCCTCCGCATCTTCCTCCATC
AGTAAGGAAAGCGTGCGTTCATCCAAATCTCGCAAAGAAA
AGAGAAGGAACGAGGAGTATGAGGAGGACCGGAGCCATCG
AAAGGCCGCAAAGAGTCGCAAGTCTAGCCCTAAAGGGAAA
AGCCAGTCCCGGAGGACCGTGGTGGACAGTCCTTCCGTTG
CGGAGCTCGAGAACAGTTACTCCTCCAAACGCAAGGCCGC
GAGCCCGAGCCCGTACAGAGAGCCGCCCAGGCGGAGCAGA
CAGAGGTCCGAGAGCCCCTACGGGAGAAGGAGGTCTTCCA
GCCCTGAGAAGGATGGGAGTCCGTATGTGAGCAGAAAACA
CTCACCTGGAAGTCCTTACGCGAGCAGACGCTCACCCAGC
AGCAGTCCAGTGTCCAGGACATCTCTGCGTGCCCGGAGCC
GTTCTCCTCACTACTCCTCGTCCCGCCGTTCCACGTCCCA
TTCTCGCTCAAAGAAACATTCGTTATATTCCGGCGGGGCC
AGCGGAGCCTCCTCTCACAGTAGTCGACCTGGCAGCCGGT
CGCCTTCATCTTCACGTTTGCCCATCACCTCCAGCCTCGG
AGCCGAACTCACAAGAAGAAAGCAGGAACGTCAGGCAGCT
GCTGCCAAGAACTCTCCTGCTCTCCAACCAAACACGTCCA
ATGTGACAAACACACCAGTGAAAAACACTGATCCACCGCC
ACTGGAGACAGCAGCAGCAGCAGCGGCGCCCCCTGAGCCT
CAAAGACCGCCCTCTCCACCTGCAATCACTGTGGCTGTGG
AGGAGCCTGCTGCGCTTCCTCCTCCACCTCTCCCATTATC
CAGTCCTCCTCCGCTGCCTCTAACGTCTCCTCCGCCTCTT
CCAGCCAGCTCTCCTCCTCCTCCTCCTCTGTCTTCTCCTC
CTCCTCTTCCTCTGAACAGTCCTCCGCCGGCTCCTCCACC
TTTAGCGCCTGCACCGGCTCTTTCTTCACGGCCGAAAAGC
CCCGCACAGAAGCCCGCGAAAAGTCCTGCGCACCAGATGA
AGACCTCCACGCTTCCTCCTCTTCCCCTGCCGCCGGCTCT
TCTGGGAGACTGCAGGGACAGTCCAAAGAAGAGTGGTCTT
TCCCAGAGGTTGTCACGAAAGGAAAGGGAGAAGGAGAAGG
AAAAGGAGAAAGAAGTGAGGACACGCCTCCTCAGTGAGTT
GCCCCTCCCTCCGGTACTTTCTGGTGGAGACCCTTCACCT
CCGCAGTCTCCTGCTCGGGTATCACCTCCGCTACTGCAGC
CCAGCTTCAAGAAGAGACCAAAGATTTGCTCTCCGAGATA
TGGAGAGAGAAAGCAGACTCAAACCGACTGGGGAAAGCGA
TGTGTGGACAAGTTTGACATCATTGGCATCATCGGAGAAG
GGACATACGGTCAGGTGTACAAGGCTAAAGACAAAGACAC
AGGAGAGCTGGTGGCATTGAAAAAAGTGCGACTGGATAAC
GAAAAAGAGGGTTTCCCCATCACCGCCATCAGGGAAATCA
AGATCCTGAGGCAACTCAACCATCGCAGCGTGGTCAACAT
GAAAGAGATCGTCACTGACAAACAAGACGCACTGGACTTC
AAAAAGGACAAAGGTGCTTTTTACCTGGTGTTTGAGTACA
TGGACCATGACCTAATGGGACTGCTGGAGTCCGGACTGGT
GTCTTTCTCCCATGAGCATGTGCAGAGCTTCATGCGTCAG
CTGATGGAGGGGTTAGACTATTGCCACAAGAAGAACTTTC
TACACCGAGATATCAAGTGCTCTAATATCCTGCTAAACAA
CAGTGGTCAGATCAAGCTTGCTGATTTTGGTTTGGCTCGT
CTCTATAACTCAGAGGAAAGTCGACCGTACACTAATAAGG
TGATCACACTGTGGTATCGCCCGCCTGAGCTGCTACTGGG
GGAGGAAAGATACTCACCTGCTATTGATGTCTGGAGCTGC
GGGTGTATTTTAGGCGAGCTCTTCACTAAGAAACCAATTT
TCCAAGCCAACCAAGAGCTTCTCCAGCTTGAGCTGATTAG
TCGTTTGTGTGGTAGTCCATGTCCTGCTGCTTGGCCAGAT
GTAATCCGGCTGCCGTACTTCAATACCATGAGACCCAAGA
AACAGTACAGGCGACGCTTACGAGAGGAGTTCTCTTTTCT
GCCCACCCCTGCTCTTGACCTGCTGGACCACATGTTGACG
CTGGACCCCTCGAGACGCTGCACAGCCGAACAGGCTCTCG
CCAGCCAGTTTCTTTGTGATGTGGAGCCCAACAAGATGCC
TCCGCCAGATTTGCCTCATTGGCAAGACTGTCACGAGCTC
TGGAGCAAGAAGCGACGGCGGCAGAGGCAAAGCGGAGTTT
CTGAGGATCTTCCTGTCGCCAAAGTCCCCCGAAAGGAACC
CGCAGGAGCTTCAGGAGGGGAAAACAGTCGCCCGCCACCG
AGTCCACCTCCGCCACCGTCATCGGCCCATCCTGCAGCCG
CTAACACAATAGCCAGTGAGCTGGAAGGTCTGGGAGCCGC
AGCGGAGCAGTTGAACCAGACGGAGCTGGCGGTGCTGCTG
AACCTGCTCCAGGGCCAGTCAGACAATCTGAGCATCCCGC
AGATGGCAGAGATTCTGCGCAGCTCCTCGTCTGAAGCCTC
CACCTCAGTCCTGTCCCGGACCCCAGCCGCCCCCTCCACC
CCTGAGCCTGACACTGCGCAGCAGCTCGAACTGCTCAGCC
AGCTCTCCACCCTAATCCAGTCCTCTAACGTCCCACAGCC
GGCAGATGCCCCGCAGGAAGACCAGGCCGGCATCCTGGCG
CTCCTATTGGAGCAGCTGATCAAGGCGCCGGCGGCAGAGG
CGGAGCGGGCCGATGAGAGCAACGGGGTTCCACCAGAGGA
GGGCGCTGCACATGCCGGCTCCGCTTCTGTCACGAGTGCC
GATAGCGAGGATTCTGCATTGGTTAAGTCCGATGCGACAG
ACTCAAAGTCAACGAAACACACTGACGACTCCACACCAGA
CGTAGCAACACTGCTTCATCTGATTTCCCAGCAGGCCTCA
GGAAGCAAAAGTCCTCCTGCAGACCTGCACCCCAATAAGG
GACCCTCGTCTCCCCCGAGCCCCAGCCCTCCATCAGCCTC
ATCTGACGCCCCATCGCCCACCTCCAGCCTGGCAAACACT
GCTTCAGAAACTCCGTTCACCCAGGACCAAGACTTGCGGT
ACACCCTAGGAGGAGCCGCCGGCCCTTCCTGAACCCCTAC
ACTCAACTTTCGATTTTTTTTTTTTCAACTTAAAAGGGTT
TGTTCACTCCAAATTTAAAGTTCTGGTGTCACTTACTGAG
CAGAATGTCACAAATGAGGATATTTTTAATCAAATCTGAC
ATTTCCGAAGCCCTAAACATTCATTTGATTTGAGTGGTTT
AATTGATCACTGTATGATAAACACTTAATTTAGGCTTTTA
TTTACATATTAACACTAATACTGATCACTTTGTTTACAGA
TTTAGTCGCAGGAGCTCAAGCATGCTTGCTTGATGTGTGA
CAACCAATGAGGTTTGTTCTTGCGAGTCACATACATTTGC
AAGAACCAATGAGGTTTATTTCCCTGCTTCATGCAGGTAT
GGTTGAGTCTCTTTTTGTTTGCTAGTGAAAGTCTGTTTAT
GAACGAGTGTCAACATGAAATCTTCATATAAAGTGACTCT
CTCTTCAGAAGACTAGGATTAAACCACTTCATATTTATTT
TTACACTTCATTTTTGGCTGAATAGACTACAGAAATCTCT
CATATTATTAAAAATACCTTCATTTGTGTTTCTAAAATTA
ACAAATGTCTAATAGTTTTGGAGGGATATCAGTAAATGAT
AGCGTTAATTTAATTTTGGGGTGAACTGACCCCTTTAAAA
TGCTTTAAATATATTTCTTTCTTCCGTTAAAGGAAACAGT
GAATGTTAAAGGAACTATTCTTGAATGCGAATGGATGATG
TTCATCCCTCCCGGCGGCCGTCTTTTCCCGACTGCAGCAG
TCTGTGAGTTTTAGCCATGTGTGCTTTCTTTGAGGGCTTC
TGTTCGTTTCTAAATCTCTGAAAAAGAAATATTTTCTTCC
TCGAGCGTTGATTTCTGAAAGGCGAGAGGCTTGATCTGGC
TCATACTTTGTTATCCTTGTGTTTTAATACAAAGGCAGAA
GGACTTGAGGTACTTTAGTGAGGCCTTTGTTTTCACAAAT
CCATTTATTAGCTTGTGCAGAAGACGTGCTTTTATTTCCG
TTTTTGATGGGGGGAGGGTAAAAAGTGTTTGCTTATTCAG
ATGTTGTTGACAGGACGAAGCGAAGTTTATTTAAATCCTA
GACGCCTTCAGGAAAGATTCAACTGAACTGAATTTTAGCA
TCAGAATCGCCGGTTGTACATGTTGTAAGATGATAATAAA
TGAAAACTGTGGCTGAGTAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations