Transcript

mpl-203

ID
ZDB-TSCRIPT-120213-751
Name
mpl-203
Previous Names
  • mpl-002
  • mpll-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000054725 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054725|OTTDARG00000023590|ZDB-GENE-060421-1 mpl|OTTDARP00000042956 mpll-002 LG_ CR854855.7 Danio rerio protein_coding KNOWN, 1840 bp
ACAGGTGAATTCAGAACCTCGCCAACCAAAGCCAGAGTTA
TTGGCTATGGATGAGGACCCAAAATGTTTCACCAGGAATC
TAGAAGACTTCACTTGCTTTTGGGATGCACCTGTTGAAAA
GTCCTATGATTTTCTTTATATAATTGAAGGATTAATGGAA
GAGAAAAGATGTGATGTGAAACAACAAACTTTTAAAGAGA
AGATCCTCAACATTTGTACATTCCCACCAAGTGACGTCTA
CCTATATGTGGAGACACACATCAGAGTGATAGACAAAGAC
ACCAACACCACCATCTACAGTCGAGCTGTCAGTGTGGAAG
ACCAGCTTCTGCTATATCCACCGTCAAACATATCCCTTCA
TCCAACTGAAGAGGTGGGCCAAATGTTAGTGAAATGGAAA
AGATCAAGCAATGAGCATGAAATTCGTTACAGCTTCAAAA
ACACAAGCACAGTTAAATCTGTGTCAGAAAATGACTATAA
GCTTGTCTCACTGGTCCCAGGAGAGAACTGCACTGTGCAA
ATGAGAGTCAAACCTAGTGGTGACTTCAAAAGATTTTGGA
GTGATTGGTCGAACCCTGTAACAGCTATGGTGCCACAAAC
AGCAGGTGACATAGAGTTCAGGTGCCACACTTCTGATCTG
ATTCAAATCATTTGCAAATGGAGGGGAGACTTATATAAGG
ACAATACATACAGCTTCTACTATAAACAATTAAACAGAAG
TTCATGGAGCAGTTGGAAGTTGTGTCCCAATTGCAATAAC
TCCATCCATCAGTGTGTCCTGTATGGCCAGAAGTCCAATG
TCTTTAAGTTTTACCTCAATACAGGGTTGCAACCATTCAG
CCGAACATTTTATGCAGAGACTTTCTATATGAACATTCAG
ACAAGGCCTCCAGAAGGTCTGAAGGTACAGATTGGGGAAG
AAAGGCTTTGTTTGACATGGGATTCACCATTTCTGATCAT
TTCTAAGCATCTAATGTACCAGATCCGTTATCAGCATCAT
GAAGAGAATCAGTGGAAGGGTTTTAAAGCTTCTGGATCCA
AGACCAGCACTTGTCTAGATGTGCACAGAGGGGGTCGATA
CACCATCCAGGTTCGAGCACAACCCAATGGATCTGTGTAC
AGCGGAAACTGGAGTGACTGGTCAAAACCTGTTACAACCA
ACCTACCTTTAAGCAAAGAGTGGATTATTTTTGTTTGCAT
ACCAGTGGCTCTGATCATCATTGCAACTGCAGTCATCTCT
TTCTTCTCCAGATACTTCCGAAAGGTCAAGAGGTCCCTGT
GGCCACCAGTACCAAACCTTAACAAGGTCCTGGAAAACAT
CCTGACTGATATCAGTGGATCACACTGGGTAATTGATAAC
TTTTATAATGATTTAGTGTATGTTCAGAAGACAGTGGAGC
CAACCTTCAACATTAAGCAATGTGATGATGACACTGCTAC
ATCAGTGGTGGAGGTTCTCACTGAGGGGGAATCTGCGGTC
AAAACCTGTAAGAACACCTGTCCTCTGCTCTCTGAGCACA
GTGAAAAACATGGAGAACATTTCAGAGAGGACTTGGAAAT
GGCGCAAGATTATGTGATTTTGAACAACAATATAATCCCC
TGCCTTACGGGAAACGACTACGTGTATAAGGATGTTGCTT
CAACACATCTGGCCAATGAAAAACAACACTCTTGCTCCAG
CACTTCTTACACCTCCCTACCAGATCACACCACAGATATT
CTCAACCAATCCTATCTCCTTTTGGCAGAACAATCCGATC
TTGGGGCGTATCAAACAACCTGTGGCCAGTACACCAATCT
GGAGATCACAGCAGTATCATGTGTAGCAATTGGAGAGTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations