Transcript

mpl-202

ID
ZDB-TSCRIPT-090929-12879
Name
mpl-202
Previous Names
  • mpl-001
  • mpll-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000030770 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000030770|OTTDARG00000023590|ZDB-GENE-060421-1 mpl|OTTDARP00000025048 mpll-001 LG_ CR854855.7 Danio rerio protein_coding KNOWN, 2175 bp
CCCCGCCCTCTCCTAAAAACATTAAGCACTTGACACAAAT
CTATCTTATCTAGACGTTAATTTTAAGTGTTGTGTATGGA
CCCCCATCAACATGGATCCAGTTTTCATCTGGTGGATTTT
ACATTTTTGTCTTTACAAACAGGTGAATTCAGAACCTCGC
CAACCAAAGCCAGAGTTATTGGCTATGGATGAGGACCCAA
AATGTTTCACCAGGAATCTAGAAGACTTCACTTGCTTTTG
GGATGCACCTGTTGAAAAGTCCTATGATTTTCTTTATATA
ATTGAAGGATTAATGGAAGAGAAAAGATGTGATGTGAAAC
AACAAACTTTTAAAGAGAAGATCCTCAACATTTGTACATT
CCCACCAAGTGACGTCTACCTATATGTGGAGACACACATC
AGAGTGATAGACAAAGACACCAACACCACCATCTACAGTC
GAGCTGTCAGTGTGGAAGACCAGCTTCTGCTATATCCACC
GTCAAACATATCCCTTCATCCAACTGAAGAGGTGGGCCAA
ATGTTAGTGAAATGGAAAAGATCAAGCAATGAGCATGAAA
TTCGTTACAGCTTCAAAAACACAAGCACAGTTAAATCTGT
GTCAGAAAATGACTATAAGCTTGTCTCACTGGTCCCAGGA
GAGAACTGCACTGTGCAAATGAGAGTCAAACCTAGTGGTG
ACTTCAAAAGATTTTGGAGTGATTGGTCGAACCCTGTAAC
AGCTATGGTGCCACAAACAGCAGGTGACATAGAGTTCAGG
TGCCACACTTCTGATCTGATTCAAATCATTTGCAAATGGA
GGGGAGACTTATATAAGGACAATACATACAGCTTCTACTA
TAAACAATTAAACAGAAGTTCATGGAGCAGTTGGAAGTTG
TGTCCCAATTGCAATAACTCCATCCATCAGTGTGTCCTGT
ATGGCCAGAAGTCCAATGTCTTTAAGTTTTACCTCAATAC
AGGGTTGCAACCATTCAGCCGAACATTTTATGCAGAGACT
TTCTATATGAACAGTAAAGTTCAGACAAGGCCTCCAGAAG
GTCTGAAGGTACAGATTGGGGAAGAAAGGCTTTGTTTGAC
ATGGGATTCACCATTTCTGATCATTTCTAAGCATCTAATG
TACCAGATCCGTTATCAGCATCATGAAGAGAATCAGTGGA
AGGGTTTTAAAGCTTCTGGATCCAAGACCAGCACTTGTCT
AGATGTGCACAGAGGGGGTCGATACACCATCCAGGTTCGA
GCACAACCCAATGGATCTGTGTACAGCGGAAACTGGAGTG
ACTGGTCAAAACCTGTTACAACCAACCTACCTTTAAGCAA
AGAGTGGATTATTTTTGTTTGCATACCAGTGGCTCTGATC
ATCATTGCAACTGCAGTCATCTCTTTCTTCTCCAGATACT
TCCGAAAGGTCAAGAGGTCCCTGTGGCCACCAGTACCAAA
CCTTAACAAGGTCCTGGAAAACATCCTGACTGATATCAGT
GGATCACACTGGGAGCCAACCTTCAACATTAAGCAATGTG
ATGATGACACTGCTACATCAGTGGTGGAGGTTCTCACTGA
GGGGGAATCTGCGGTCAAAACCTGTAAGAACACCTGTCCT
CTGCTCTCTGAGCACAGTGAAAAACATGGAGAACATTTCA
GAGAGGACTTGGAAATGGCGCAAGATTATGTGATTTTGAA
CAACAATATAATCCCCTGCCTTACGGGAAACGACTACGTG
TATAAGGATGTTGCTTCAACACATCTGGCCAATGAAAAAC
AACACTCTTGCTCCAGCACTTCTTACACCTCCCTACCAGA
TCACACCACAGATATTCTCAACCAATCCTATCTCCTTTTG
GCAGAACAATCCGATCTTGGGGCGTATCAAACAACCTGTG
GCCAGTACACCAATCTGGAGATCACAGCAGTATCATGTGT
AGCAATTGGAGAGTGAGGTTTACTGTCAAAATGAAGCTCA
TAATCATGTATATATTAAGGGTTCTCTCACAAATGTAAAA
AAGACATTCAGTTTCTGTGGAATGAATGAGAAACAAAGGA
AAAGCAAAGCTTACGTTAATGGAGCACTTATGAAGGTAAT
GTGAATCTGTAGCGCATGTTGTGTATTTTGAGTTGAGATT
ACGCAAAACGTGAATCTTTACCATAAAGAACTGCACTAGC
TTTGTCATAATACAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations