Transcript

pcdh9-202

ID
ZDB-TSCRIPT-120213-662
Name
pcdh9-202
Previous Names
  • pcdh9-001
  • ch211-165a18.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000054250 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054250|OTTDARG00000037899|ZDB-GENE-120215-98 si:ch211-165a18.1|OTTDARP00000042622 CH211-165A18.1-001 LG_ CR847522.6 Danio rerio protein_coding NOVEL, 3753 bp
GGGGAAGAGGAGAGAGCGAGGATAAGCATCCCAACACATC
TCACCGTTTGGACTTTTTCCCTCATTCAGGTGTGCGCGGC
GAATCACGCACAAGACACCGGGACTGAAGCCGTGGATTTT
CTTTCTAGCTGAGGACTGAGTGAGGAACGATCTGATCGTA
TTTCAACTTGACTCTTTTTTTCTCAGATGGGATAGTTTAT
GTTTATATTTGAGCAGAACAGGTGCATTTCTGAAGGGCTC
CTCCGGTAATGCGGAATGACCGTACGGGACCGTTAACGCG
CGCGTGGATCACCTGATTCATCACCGACCACCGCATTCCG
CGCGCCACCGATCTGCGGGAGAAAGTTAATAAAGATTGTC
TGATTGATTACTGCTAAATCAACATTTCCTCCCAAAAACC
AGCTGTTCTTTGAATTGGATTTTTTTTGCACGTCTAAAAT
ACTTAAATATTCACTGACCTAGTCCTCTAAGCAGTGATCA
GCACGGATACCTTCATTTTATATTGGAGTCGGATCATTTT
TCTGGCTGCTTGATCGGATTTGTCACTATGTCCGTGAATT
GATAACCTCCGTATGAGCAAGCTCACAGTGAACCGAGGGT
CGTGTTTGGCTGCACTTTATCTACAAATGTAAGGCTCTGT
GAAACCTTGGCTCTGACAACACCATATGGAGACAACTGTT
TGAATTAAAGCAGCGGGAACACGCGTGAACTGCTGTCATG
GATTTAAGGGATTTTTTCTTGTTGGCAACATTAGTTGCTT
GTTTCTGGTTAGATCCAACCATAGCCCAAGAGCTCATTTA
CCCTATCCGAGAAGAGCTACAGGAGAATGTTCTTATTGGA
AACATACCAAAGGACTTGAACATCTCTCATATGAACTCTG
CCACCGGGGCTACCAGTAATCTGGTTTACCGACTTGTTTC
AAAAGCAGGTGACACCCCGCTACTTAGAGTGATGAGCAAT
ACTGGAGAAATCTTTACCACCTCCAACCGAATAGACAGAG
AGAAACTCTGTCCTGGCCCCTCTTTTGAGGACAGCGAGTG
CTCCTTTGAAATCGAGGTGGTCATTTTGCCCAATGACTAT
TTCAGATTAATTAAAATTAAAATCATTGTCAAAGACACCA
ATGACAATGCCCCCATGTTCCCCTCGCCTGTGATCAACAT
TTCAATTCCAGAAAACACGCTCATCAACAGCCGCTTTGCT
ATTCCTTCTGCCACTGATCCAGATACCGGACCTAACAGCG
TACACAAATATGAGCTGCTGAATGGGCAGAGCGCCTTCGG
TTTGGATATTGTAGAGACCCCAGAGGGTGAGAAGTGGCCT
CAGCTCATTGTTCAGCAGAATTTAGACAGAGAGCAGAAAG
ATACGTATGTTATGAAAGTCAAAGTGGAGGATGGGGGGAA
CCCACAGAAATCCAGCACTGCCATTCTACAGGTGACCGTC
ACTGATGTTAATGATAACCGACCTGTCTTTAAAGAGAGCC
AAATTGAGGTTCACATCCCAGAAAATTCCCCTGTTGGCAC
ATCGGTAGTCCAGCTGCAAGCCACCGATGCAGATGTGGGG
GCTAATGCAGAAATAAAATACATGTTCGGTGCTCAGGTGT
CTCCGGCGACACGGAGACTTTTCGCTCTGAACACCACCAC
CGGGCTCATAACAGTTCAAAGGCCACTTGATAGAGAGGAG
ACTGCCATTCATAAACTCACAGTACTAGCCAGCGATGGAA
GCTCGAGTCCAGCAAGAGCCACTATCACTATTAATGTGAC
TGATGTGAATGACAACGCTCCAAACATTGACCTAAGGTAC
ATCATCAGTCCAACCAACGGTACTGTGATGCTTTCTGAAA
AAGATCCAATTAATACTAAAATCGCCCTCATTACTGTATC
TGACAAAGACACGGATGTCAACGGCAAGGTTATTTGCTTT
ATTGAAAAAGATGTTCCCTTTCATCTCAAAGCAGTTTATG
ATAACCAGTATTTGTTAGAAACATCTGCACTGCTTGATTA
TGAAGGAACAAAGGAGTACATCTTCAAGATCGTGGCTTCT
GACTCTGGAAAACCTAGTTTAAACCAGACCGCCCTGGTCA
GAGTACGGCTGGAGGATGAGAACGACAATCCGCCCATTTT
CACCCAGCCTGTCATCGAGCTGGCGGTCATGGAGAACAAC
CTGCGCGACATGTTCCTGACAACCATCAGTGCCACGGATG
AGGACAGCGGACGAAATGCAGAGATTGTCTACCAGCTTGG
ACCCAACGCATCATTCTTTGATCTTGACCGCAAAACAGGA
GTGCTAACAGCATCCAGGGTGTTTGATAGGGAGGAACAAG
AGCGGTTCCTCTTCACAGTCACCGCTAGAGACAATGGCAC
CAGGGCTCTGCAGAGTCAAGCTGCAGTAATAGTGACTATA
CTTGACGAGAATGACAACAGTCCTAAATTTACACACAACC
ACTTTCAATTCTTTGTGTCGGAGAATCTGCCTAAATATAG
TACGGTTGGCGTAATCACAGTCACAGATGCAGATGCTGGT
GAGAATGCAGTGGTGAGGCTCTCAATCCTTAACGATAATG
AGAACTTCATCCTCGACCCAGATTCTGGAGTCATAAAGTC
CAATGTTTCCTTTGACAGAGAACAGCAAAGCTCATACACC
TTTGATGTTAGAGCTGTGGACAATGGAAGCCCTCCATGTT
CGTCAGCTGCCAAGGTGACAATAAATGTCATCGATGTCAA
TGATAACACCCCCATTGTCATCTACCCACCATCCAATACC
TCTTTCAAACTAGTCCCACTGTCTGCGATTCCAGGGTCTG
TTGTGGCTGAGGTGTTTGCAGTAGATGGTGATACAGGTAT
GAATGCAGAACTCAAATACACTATTGTGAGTGGCAATGTC
AGAAGTCTTTTCAGGATTGACCCTGTAACAGGAAACATCA
CATTAGAGGAGAAACCTACAATCGCAGACATTGGCCTCCA
CAGGCTAGTGGTCAACATCAGTGACCTTGGCTATCCTAAA
TCCCTGCACACCCTTGTTCTTGTTTTCCTGTTTGTAAATG
ACACAGTTGGAAATTCCTCATATATACATGATCTAATCCG
TCGGACAATGGAAACGCCGCTAGATAGGAACATTGGCGAG
AGCAGCGAGACTTATCAAAATGTTGACAACCTAAAAACCA
TCATTGCCATCGTGACAGGTGCTATGGTCGTGATCGTGGT
CATCTTCATAACGGTTTTAGTGCGCTGCCGACATGCCTCA
CAGTTTAAAGCTGCTCAGAGAAAGAAACAGGGTGCCGAGT
GGATGTCCCCCAACCAGGAAAACAAGCAAAACAAGAAGAA
GAAGCGCAAAAAGAGGAAGTCACCAAAGAGCTCCCTCTTA
AACTTTGTCACCATCGAGGAGAACAAACCCGACGACCCCG
CCCACGAACCCATAAACGGAACCATCAGTCTCCCAGCTGA
GCTCGAAGAGCCTGGGATTGGACGCTTTGATTGGAATGCC
ACCCCTACCACCACCTTCAAACCCAGCAGCCCAGACTTGG
CCCGGCACTACAAGTCCGCTTCACCCCAGTCAGCCTTCCA
CCTCAAAGCTGACACTCCGGTGTCTGTGAAAAAGCATCAC
GTCATTCAGGAGCTGCCACTGGACAATACCTTTGTTGGAG
GCTGTGATACGCTTTCCAAACGTTCCTCCACCAGCTCTGA
TCACTTCAGTGCCTCAGAATGCAGCTCACAAGGAGGCTTC
AAGTCAAAGGGGGCACCTTTGCACACCAGACAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations