Transcript

pax10-202

ID
ZDB-TSCRIPT-120213-567
Name
pax10-202
Previous Names
  • pax10-002
  • pax6l-002
  • ch73-367p23.5-002
  • zgc:193504-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000053537 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000053537|OTTDARG00000037488|ZDB-GENE-081022-10 pax10|OTTDARP00000042109 CH73-367P23.5-002 LG_ FP236454.4 Danio rerio protein_coding KNOWN, 1043 bp
CTGATATATTTGAGAAGAGGGACTATGGGTCACAGTTCTT
TTACTCTGAAAGCTACAAAAACTACACTGAGCACTGGCAT
GTTTGGATTCAAATCAGGACCCCGATGTGGATGTCAGCAG
TGTGGAGGGTGAAACTCAGTGACCGCGGGCCTTCATAGAG
CAGTCTAACATTAACAAAGCAGGAGAGCAGAGAGAAGGAG
AGAGGGATGAACAGAAAGTGATAGAGACACTGAGCAAGTG
TGGAGCACTTTTACAATTCATTCATCTAAGCAGGATTGGA
GTGGTCTGGATGCTAGAAAGAGAGGGCAAGGGTTTTCTCA
CAGGTGACATTTGATGTATGACAATCTGACCATGCTGAAC
CTACAAAACAGCTCCAACTGGTCCGGCCCTAACAACTGGT
ACCACCCAGCCGACACCATCACCCCTCAACACGGCACAGA
TGGTTGTGTGGAGGATCTGAATGTGCAGATGGCCGGAGCA
GGGGAAGGAGTGGTGCAGGGAGAGAGGGATGAGGTGGACG
ATTCGCAGCTACACCTGCAGCTCAAGAGGAAGCTGCAGAG
AAACCGCACCAGCTTCACCCAGGAGCAGATCGATGCCCTC
GAGAAAGAGTTTGAAAGGACTCATTACCCAGATGTCTTTG
CTAGAGAAAGACTGGCTGCAAAGATTGATCTTCCAGAGGC
TAGAATTCAGGTATGGTTCTCCAATCGGAGAGCTAAGTGG
AGAAGGGAGGAAAAGCTGAGAAACCAGAGGAGATCAGGGA
GCAGCAGTTCCTGTTCTCAGACACATACTCCCCTGAGCAC
GTCCTTTAACTCCCCTGTATATCACTCCCATCACAGCAAC
AGCTCAGGCTCAATGCACAGTCGGAGTGATTCTTCTCTCT
CAGGCTACAGCTCTCTGTCTGTCTTCTCCAGTATGCAGTC
TTTGCCCTCCCAGTCCACTCCAACTTACTCCTGCATGTTG
CCTCCCTCTCCTTCTGCTCTTCCTCCTCTGTCCCGAAAAT
TTGACTCATCTTACACCTCTCCCCACCTTCCACCCCCACC
TAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations