Transcript

pax10-201

ID
ZDB-TSCRIPT-120213-182
Name
pax10-201
Previous Names
  • pax10-001
  • pax6l-001
  • ch73-367p23.5-001
  • zgc:193504-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000053536 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000053536|OTTDARG00000037488|ZDB-GENE-081022-10 pax10|OTTDARP00000042108 CH73-367P23.5-001 LG_ FP236454.4 Danio rerio protein_coding KNOWN, 941 bp
CAGGATTGGAGTGGTCTGGATGCTAGAAAGAGAGGGCAAG
GGTTTTCTCACAGGTGACATTTGATGTATGACAATCTGAC
CATGCTGAACCTACAAAACAGCTCCAACTGGTCCGGCCCT
AACAACTGGTACCACCCAGCCGACACCATCACCCCTCAAC
ACGGCACAGATGGTTGTGTGGAGGATCTGAATGTGCAGAT
GGCCGGAGCAGGGGAAGGAGTGGTGCAGGGAGAGAGGGAT
GAGGTGGACGATTCGCAGCTACACCTGCAGCTCAAGAGGA
AGCTGCAGAGAAACCGCACCAGCTTCACCCAGGAGCAGAT
CGATGCCCTCGAGAAAGAGTTTGAAAGGACTCATTACCCA
GATGTCTTTGCTAGAGAAAGACTGGCTGCAAAGATTGATC
TTCCAGAGGCTAGAATTCAGGTATGGTTCTCCAATCGGAG
AGCTAAGTGGAGAAGGGAGGAAAAGCTGAGAAACCAGAGG
AGATCAGGGAGCAGCAGTTCCTGTTCTCAGACACATACTC
CCCTGAGCACGTCCTTTAACTCCCCTGTATATCACTCCCA
TCACAGCAACAGCTCAGGCTCAATGCACAGTCGGAGTGAT
TCTTCTCTCTCAGGCTACAGCTCTCTGTCTGTCTTCTCCA
GTATGCAGTCTTTGCCCTCCCAGTCCACTCCAACTTACTC
CTGCATGTTGCCTCCCTCTCCTTCTGCTCTTCCTCCTCTG
TCCCGAAAATTTGACTCATCTTACACCTCTCCCCACCTTC
CACCCCCACCTACGGCCAGCGCAAACACAGGATTCTTTGC
AGGAGTTTCTGCAGCGGGCCAGACTGCAGTTCAAGGTGGC
GATCAGGAGCTGGGACAAGGTCTGAGTCAGTACTGGACGA
GACTGCAGTAAACAACACACTTTATCATGTTCAGACAAAA
CCAGCAGAGCTTCAATCAGCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations