Transcript

entpd8-203

ID
ZDB-TSCRIPT-120213-386
Name
entpd8-203
Previous Names
  • entpd8-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055055 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055055|OTTDARG00000002185|ZDB-GENE-040724-142 entpd8|OTTDARP00000043177 entpd8-002 LG_ AL732598.10 Danio rerio protein_coding KNOWN, 1387 bp
CTGGAGTAAAGGTGTGGAGGAATCAACATCCCATATACCT
GGCTTCAATATACGGGATATACTTTGTTCATAAAGAAAGG
AAAAAAGACTGCAGAAATGGTTCATATGAAGGCTATTTTG
CTGGGTGCTGCAATGGCAGCCGTGGCTGTGACAACCATCA
TCGCTTTGATTCTGGCTCTTGCAAACCGGCAGACTTTGGA
TCAGCCATACTCAACACAGTTCGGGATTGTTTTTGATGCC
GGCTCCAGCCACACTGCCCTTTTCCTGTACCAGTGGCAGG
GAAACAAAGAAAACAACACTGGAATCGTGTCGCAGAAACA
GAGCTGCGATGTGGATGGTGATGGCATATCAAGCTATGTC
CAGAACCCTGCAGGAGCGGGAGAAAGTCTGAAGAAATGCT
TGGACATTGCTAAGGCAGCAATACCAACAGAACAGCAGAA
GTCCACACCTGTGTACCTCGGTGCCACTGCTGGCATGCGG
CTTCTAAACTTACAGAACCAAACTCAATCAGACAGCATCC
TTGCAGAGGTCGCCAAAACAATTCAAACTTACCCATTTGA
TTTCCGAGGAGCCAGAATACTCACAGGGATGGAGGAGGGA
GCTTATGGCTGGATCACCACCAACTACCTCTTGGAGAGCT
TTATTAAGGTAAGGTGCACTTTACAATGCTGATAATAATA
GGATGATATAATAATATGCTAATATATGGCTATTTTGCTA
GATACTGTATATACAGTACACGTCTATCATCAGAGGGATT
GCTTGTTGTTATATATATATATAAGGGGTTTTATACTTTT
AAGTTTGACAGGACAGTAATGAGTGTAGACAGGAAAGCAT
GGGGCAGATATAGGGGAAGAGACAGCGAGTTCAAAATTGA
ACTTGGTATGCAGCAAGCACCTTGATATTACTGGCACACA
TTAATATTATTTAGAGAGGGGTCTGGATGTAGACTGGGTG
CAGTTGCAAGGTTAGATGCATGCAATGCTTTTCATGTGCA
CACCTAACCCCGCCCACAGAAATGGGCAAAAATACCTAGA
AATGTATTAAAAAAATACAAAATATATAAATTTTAAATGT
ATCAAAATAAACTACTAAATACAGCAACCATAAATGTATC
AAAATAAAATACTGTATTTTATGACTTCAAAATACTTCCA
TCAATAGACCTATTGGATCAATTCCTACACCATGAAGCTG
ACTTAGTAAAATACTCAATGATTGATCGAAACAACTTTTC
TCTGCCACTTTGTTCCCCTGTAGGGTAAGTTGTGGCCTAA
TGGTTAATGAGTTGGACTTGTAATCCAAGGTAACTTGTGT
TTCTTTTTGAGTTACAAATTACAATCCATCCAGTTCTTCT
TTAACTGGAAGATTACTCTCCTAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations