Transcript

entpd8-201

ID
ZDB-TSCRIPT-090929-195
Name
entpd8-201
Previous Names
  • entpd8-001
  • si:ch211-10e8.4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000002356 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000002356|OTTDARG00000002185|ZDB-GENE-040724-142 entpd8|OTTDARP00000002083 entpd8-001 LG_ AL732598.10 Danio rerio protein_coding KNOWN, 2484 bp
AGTAAAAGTCATGTTTGTGTGTGTGTTGTGCTACAATGTT
AAACCAAGGACTTTAACACAATAGATACCCAGAGAGATTA
GTTATTAAGTAACAGTTGTTATTGGTGGAGAAGGTTAGTG
CATGGTTTCAGTTTGATTGAGATAAGGGCTGTTTTTCAGT
TCCCACATATCAGAGGACATCCTGTCAAATTCTTCAAGTA
AAACCTGCTGGAAATTATTCAGCCTGTGACAGTAATATAA
CTGGACTCGAGCCAGTCAGGCTTTGAGGTTGTAAAGCAGG
GTGTGTGTGTGTATGTATGTGTGTGTAGAGGAAAAGTTGG
TGAGTGTGCTGTTATGTGTGTGTGTGTGTGTAATGAGCTG
AAGATATACTGGGGAAGTGGGAGTTTAACTTCAGTTTCCA
GAGGCCCGGCTGGAGTAAAGGTGTGGAGGAATCAACATCC
CATATACCTGGCTTCAATATACGGGATATACTTTGTTCAT
AAAGAAAGGAAAAAAGACTGCAGAAATGGTTCATATGAAG
GCTATTTTGCTGGGTGCTGCAATGGCAGCCGTGGCTGTGA
CAACCATCATCGCTTTGATTCTGGCTCTTGCAAACCGGCA
GACTTTGGATCAGCCATACTCAACACAGTTCGGGATTGTT
TTTGATGCCGGCTCCAGCCACACTGCCCTTTTCCTGTACC
AGTGGCAGGGAAACAAAGAAAACAACACTGGAATCGTGTC
GCAGAAACAGAGCTGCGATGTGGATGGTGATGGCATATCA
AGCTATGTCCAGAACCCTGCAGGAGCGGGAGAAAGTCTGA
AGAAATGCTTGGACATTGCTAAGGCAGCAATACCAACAGA
ACAGCAGAAGTCCACACCTGTGTACCTCGGTGCCACTGCT
GGCATGCGGCTTCTAAACTTACAGAACCAAACTCAATCAG
ACAGCATCCTTGCAGAGGTCGCCAAAACAATTCAAACTTA
CCCATTTGATTTCCGAGGAGCCAGAATACTCACAGGGATG
GAGGAGGGAGCTTATGGCTGGATCACCACCAACTACCTCT
TGGAGAGCTTTATTAAGCACACATTTGAGGGCTCCTGGAT
CCACCCTAAAGCCGGAAAGATCATTGGAGCTCTCGATCTC
GGTGGTGCATCAACACAGATCTCCTTTACCCCAAAAGACC
CAGTCAGAGACCCAAATTCAGCATTTAATCTCCAACTTTA
TGGGTATAAATATGAGTTGTACACTTACAGCTACTTGTGT
TACGGCAAAGACCAGGCTTTGAAGAAACTCCAAGCCTACC
TTCACAAGAATGCGGGATCATCATCATCTATCAGTCACCC
CTGCTACCACAAAGGATATAATCTCAATCTTACTCTGGCT
GAACTTTACAACTCCCCTTGTGTGGTCCCACCAAGCAGTT
TCAACCCCAAGGATACAATCCTTTTTAAGGGAACAGGAAA
TTCATCCCTTTGCCTATCTCTAATAGAAAACATTGTTAAT
CTCACTGGTTGTGCATTATCCCCTGACTGTGGCTTCAATG
GCATCTATCAGCCTCCAGTCAACGGCGAATTCTTTGCTTT
TTCTGCATACTTCTACACATTTGACTTCCTCGGTCTTACT
CCAAAAGCTCCACTAACAAAAGTTCTTTCCACTATTGACA
CTCTCTGCAGCAAAAACTGGACAGCTCTAACTGCTGAAAA
TCCATCCATTAAGCCAAAATACCTGAAAGATTATTGTGCT
TCTGGTCACTATATTACTACTATTCTCTTGAAAGGATACA
AGTTCAATAACACCTGGGATCAAATTTCTTTTGTAAAACA
GGTTGCAGATACAGATATTGGTTGGACGCTGGGCTACATG
CTGAACCTGACCAACATGATTCCTTCTGAACGCTCCAGTG
CCGTTACTGGAGTGCCACACAGTCAATGGGCCGCTGAGAT
TTTCTTCATCGCATTTGCCCTCTTCCTCACTCTACTTATT
ATAGTCATCCTATCTGTCCGTGATATAACTAAGTAAACTG
TGTTATGAATATATGTATGTACATTAGTATTTATCAGATA
ATAGACATGTAAATGGACGAGGAACTATTGTTTACACAAA
CACTGAACTCTTTTTTTTTTCATTCTGTACATTTGTAGTT
GATATTTCTTCATAACTTATTCAAAGTAGTGTCTTGTTTT
TTATGGCTGACTAGTTCATACCTCAATCATTTAGTCTGTG
CCAAATAATAATACATGAAATTTGGTTACAGAGATTTTTC
TTTATTCATAAACTGAATTATGGGAGTTTAGTTTTTTTAA
GGAACAAAAAGCACTTAACAGATATTAAATAAAGCTATAG
TTACATTATTATAAAAATGAAGAAAATGTACTGTGCTTTG
TACATATTTATAGAATTAAGCAATATTGTAAAAGCAGCTT
GTGTTTCCAGTTTAGCCTTCACTTTTTGTTTGGGGTCAGT
AAGATTTTTACAAATTTCTAAAATAAAACATTCCATTGTT
TTAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations