Transcript

nfe2l2b-201

ID
ZDB-TSCRIPT-120213-328
Name
nfe2l2b-201
Previous Names
  • dkey-3d18.4-001
  • si:dkey-3d18.4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000054481 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054481|OTTDARG00000038047|ZDB-GENE-120215-151 si:dkey-3d18.4|OTTDARP00000042799 DKEY-3D18.4-001 LG_ BX546447.8 Danio rerio protein_coding NOVEL, 3002 bp
CTGAAGATCGTTACCGAATTCCTCATCTGCTTGTTGATTG
GCTGGTGGATATTGTGGGAGGCTCCCATGTGTATTTGGTT
CTGTTACACACGCGTGTCGTCAGATTTGATTCAGAAATAT
GCGCGCTGTCGTGTGTGTTGCTTCTCCATCATAACATCAG
CTGGAAGACATGGACGACCTTTCAGCTCAATTTCAACACG
AGTCGGCTGTGATTGATATTTTATGGAGGCAGGATGTGGA
TTTGGGGGTGGAGCGCGAGATCTTTGATGGATGTCTCCGG
CAGAGGGAGGAGGAGACCATGAGAGAGAGAACAAGAGAAA
GAGACTTGAAAAGAGAGAGAGAGCTTGAAAGGATAATGCA
GAGGTTACAGAAACTAGACGAGGAAACTGGAGAGTGTTTG
CCCAGCCCTTCATCTGTGAACTCTCAGGCTGTGCCTTTCT
CAGAAATGTTACCCTCTACGATGTCGATTCAGTCTTCACC
TGTTACCCAGAATCCCTTGTTGTCTGCCCTGCTGTTTTCT
CAGAAGCCTCAGAAGCTTCCTTCTCAGAAGCAGGGTTTCG
GTGAGCTGGCGTCGCTGCCAGATTTACAGTATTATCTGGA
TGTCTTGGAGTCTGACAGCTCAAGCTTGCCCCTAGAGGAC
ATCGCTGAAATCTGCCAACCTAACCTCCCCGATCCACATC
CAGAAAACTCAACAGATGCTTTCTGCTGCGTCAGTGAACT
CACACAAGCCATATCAGACTCTTTAACATGCCTGCCCTCT
GATCCAGTAGAAGTCCTGGAAACATGCATACAGACACTCT
CGGACTCTAGTAACTCTATGTATTCCCCCTCAAATGCAGT
CTACAGCCCTGAGAGCGAACTCATTTTACCGAAAAGCCAG
ATAAACGATTCGGTCCTCAGTGAGTTTTGCTCTGAGCTGA
ACACATACACCATTAATGCTGACCAATTAAACATGGCGCC
TGCCCAACAGACTCTCTCACAATTCGAGGAGCGCCACGTT
ATGCTGGGTTTTGATGACTCGGCTTCTGTGGGCTCTGTAG
ATTTAGAGACTTCCCTCTATGAGTCCTTAAGTAATGAACA
GTCGGACAAAGACGAGCTGGAGAGCATCCAATCAGATTAC
ACTGATCTGCTATCGTTGTCCGCAGACGCAATGATGTATG
AAACTGTTACAAATGCACAAGAACAAACGCAAAAGACTAG
AGTTCGCCGCGGGTGTCGTGACGAACAGCGAGCCCAAGCG
TTGAGTTTGCCTTTAAGTGTGCATGACATCATTCACCTGC
CTGTGGAAGCGTTCAATGAAGCTATTAGCACATGTAAACT
CAACCACGCTCAACACACACTTATCAGAGATATTCGGAGG
CGGGGTAAAAATAAGATGGCCGCCCAAAGCTGCCGCAAGC
GGAAGATGGATAGTCTCTTCGGGCTCGAAGACGAAATCGA
GGACCTGAAGAGGAAGAAAGATCAATGCATGGAAGAGAAA
GAGAGGAACGCTAGAGAACTTTGTGAGACGAAAGAGAAGG
TGGGGAAACTTTACAACGAGGTGTTCAGACTGTTGAAAGA
CGAGCATGGGAACTCGTACAATCCCAGAGAGTACAAACTA
CAGCTTAGCACTGACGGCACGGTTTACCTGCTGCCTCGTA
ACACAGCTCACAAGAACAAGATGTCAACAGGGGATTTAAA
TGTTGCTGTATAACAATTCAACGACTCTATCTGTGGTTTT
ATTGAGATGTTGTGGGCCTTATTTATGAACTCTTGATGAC
ATACTATGAGCACTTGTGATCAGATTAGTTGATTTTATTG
ACTTGACCGACATCGTCATTCTAGCTTCTGGTTTCAATCA
TGCATTAAGGCCACTGTCTAATTGAAATGAGGACTCTTAT
TTTGAAAACAGGGATTGTAAAAAGGAGCAGTCTTGTGAAG
CAGGCATTCAAGGACAACCGCATAATGTTCACAGCTCTCC
CGAATGTAAAATGTGAGATTATAAGTTTATTCTGTGCTTC
CAAAAGAGACAACCTCTGTTTAGAGGTATATTTTGTCAGT
TTAACAAATAAATATTGTGATATTTCCTGTGTTTATTTGT
AATGAGGCAACAAATACATGTAAACCACTTAAAATATGTG
TTTAATGCAGGTTTATGCATCGTGTCATATCTCTCAGCTC
TTTCTGTGGTTTTTCCTAAGTGAAAGGATGCCAGTCCACT
TCATAAAACTCGTACAGTCCCAGAGAGTACAAACTACAGC
TTAGCACTGACGGCACGGTTTACCTGCTGCCTCGTAACAC
AGCTCTCAAGAACAAGATGTCATCAGGGGATTTAAATGTT
GCTGTATAACAATTCAACGACTCTATCTGTGGTTTATTGA
GATGTTGTGGGCCTTATTTATGAACTCTTGATGACATACT
ATGAGCACTTGTGATCAGATTAGTTGATTTTATTGACTTG
ACTGACATCGTCATTCTAGCTTCTGGTTTCAATCATGCAT
TAAGGCTACTGTCTAATTGAATTGAGGACTCTTATTTTAA
AAACAGGGATTGTAAAAAGGAGCAGTCTTGTGAAGCAGGC
ATTCAAGGACAACCGCATAATGTTCACAGCTCTCCCGAAT
GTAAAATGTGAGATTATAAGTTTATTCTGTGCTTCCAAAA
GAGACAACGTCTGTTTAGAGGTATATTTTGTCAGTTTAAC
AAATAAATATTGTGATATTTCCTGTGTTTATTTGTAATGA
GGCAACAAATACATGTAAACCACTTAAAATATGTGTTTAA
TGCAGGTTTATGCATTGTGTCATATCTCTCAGCTCTTTCT
GTGGTTTTTCTGTGGCCAGTACACTTCATAAAACTCGTAC
AGTCCCAGAGAGTACAAACTACAGCTCAGCACTGACAGAA
CGGTTTACCTGCTGCCTCGAAACACAACACTCAAGAACAA
GATGCCAACAGAGGATTTAAATATTGCTGTATAGCAATCA
TAGACTGTAACAGATATGGACGTAGTATCCATGACGTCAC
CC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations