Transcript

zgc:77517-202

ID
ZDB-TSCRIPT-120213-1158
Name
zgc:77517-202
Previous Names
  • dkey-195m11.4-002
  • zgc:77517-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055084 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055084|OTTDARG00000022018|ZDB-GENE-040426-1508 zgc:77517|OTTDARP00000043201 DKEY-195M11.4-002 LG_ CR753817.13 Danio rerio protein_coding KNOWN, 1302 bp
CGCACACTCATCTTCTACTGCAGCCAGAGCTTCATTCCTC
CAAAACCATGAGCTTCTACGCACCCCAGGCCTCTCACATC
TCCTTCACCCGCTCTGCGCCCGCTTACCGGGCTGCCAGTA
CGTATGGTGGGGCAGGTGGGCAAGGCACCAGAATCTCATC
CGCTTCTGCGATGTCTTATCGTTCAGCCCCTAGAAGTGGG
GGAATTTCCTCTTCCACAGCCTTCAAGGTGAGCTCAGCCG
GCATGGGCTCTGGCGCAGGGGGTTCCTTCTTGGCGAGCTC
TGGGTCCTCAGGTGGCATGCTGGGCAATGAGAAAGGCCAG
ATGCAGAATTTAAACGACCGTCTGGCTGCTTACCTGGACA
CAGTGCGCAGGTTGGAGCAGGAGAACGGCAAACTGGAACA
GCAGATTCGAGAGGCTCTGGAGAAAGGTGGACCAGAAACA
CGCGACTACAGCAAGTACAACGCCATCCTGGATGACCTGA
GGAGGAAGGTGTTTGATGCCACTGTGGACAATGCTCGTCT
TGTTCTGCAGATTGACAACGCTCGTCTGGCTGTGGATGAC
TTCAGAGTCAAGTTTGAGAATGAGATGGCAATCAGGCAGT
CTGTGGAAGGAGACATCGCAGGTCTAAAGAAAGTTATAGA
TGAAACCAATATTGGTCGCCTGAATGTGGAGGGAGAAATC
GAGTCCTTGAAAGAAGAGCTTGTCTTCCTCAAGAAAAACC
ATGAAAATGAAGTTGATGAGCTACGGAGCCAGATCTCTCA
GTCAGGCGTTCAGGTGGATGTTGATGCACCCAAGGGCCAG
GATATGTCTCAAGTGATGGAAGACATGAGAGCTAACTATG
AGAAACAGGCTCTCAAAAATGCAGAGGAACTCAAAATGTG
GCATGAAACCCAGATAGCAGATGTTCAGGTGCAGGTGGCT
CAGAACACAGAGGCATTACAAGGTGCTCAGATGGAGTGTA
ATGACCTACGCCGACAGATTCAAACACTAGAAATAGAGCT
TGCATCACAACAAAACCTGAAAGCGTCACTTGAAGATACT
CTACGAAACACTGAGATACGTTCAAATGGAGAGATGGAGA
AGTTAAATAACATCATAATTCAACTTGAAGCTGAGCTGGC
ACAGCTGAGGGCAAATATCACAGAACAGGGACAGGAATAT
GAAGCACTCCTTAATATGAAGATGAAACTGGAAGCGGAAA
TTAACACCTACAAGAAACTTCTAGATGGGGAAGATTTCAA
GTAAAGAGGAAAAGTTTAATTCTTGTATTTCATAGGGCAT
TAAATACAGTCACTGATTCTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations