Transcript

aptx-002

ID
ZDB-TSCRIPT-110912-883
Name
aptx-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052560 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052560|OTTDARG00000019452|ZDB-GENE-040628-2 aptx|no_translation aptx-002 LG_ BX004781.7 Danio rerio protein_coding KNOWN, 867 bp
CGAACAAGAGCGAGCGAGCGAGCGTCATGTGTTGCACTTT
TATGTTTACGACTACCACACTTTTTTCTACCGTAGCTTTA
TTACACTAACACAGAGATGCCTGTGTGTTTACTAGTAAGT
GAAGATAATTCACACAAACCCATTGAGCTCCATCACCAAC
AGTCTGTGACTCTGGGTCGAGGACCAGACACTAAGATAAA
AGACAAGAAGTGCTCTAGAGAACAAGTTGAATTGAGAGCT
GATTGCAACAGGGGATTTGTCACTGTTAAACAGCTGGGTG
TGAATCCGACACTTGTGGATGATGTGGTTGTGGGCAAAGG
CAATCAGGTGAGCATAAAGCCGGGTCAGAGACTCTACATG
GTCAATCAGCAGTATCCTTACAGTGTGAAGTTCACGGAGG
ACACGTCCAGATCCAAACCCTCCAAAAGAGCCCAGCAGAT
CCAGAGCCCTACAAAAACAACAGCAGATGTGTCAGACAGC
CCACCTCCACCCAAAAAAACAACACCACCTGCTGGTGAAA
AATCGGAGTCTGCTGGGCACTGGAGCCAAGGACTTAAAGC
GTCAATGCAGGACCCCAAAATGCAGGTGTATAAAGACGAC
AGCGTGGTGGTAATCAAGGATAAATACCCGAAGGCTCGTT
ATCACTGGTTGGTTTTGCCGTGGCAGTCGATCTCCAGCCT
GAAGGCACTGCGCTCCGAGCACGTGGAGCTGCTCAAACAC
ATGCAGCGGGTGGCAGATCAGATGGTGGAGCAATGTCCTG
ATGCCCACAAACTGAGCTTCCGGCTCGGCTACCACGCCAT
TCCCAGCATGAGGTACACGCCCCTGCACACTGATTGGCCT
GTGATGAATTAAAGAAGACCTATTATG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations