Transcript

aptx-203

ID
ZDB-TSCRIPT-110912-587
Name
aptx-203
Previous Names
  • aptx-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052559 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052559|OTTDARG00000019452|ZDB-GENE-040628-2 aptx|OTTDARP00000041315 aptx-003 LG_ BX004781.7 Danio rerio protein_coding KNOWN, 797 bp
ATGTTTACGACTACCACACTTTTTTCTACCGTAGCTTTAT
TACACTAACACAGAGATGCCTGTGTGTTTACTAGTAAGTG
AAGATAATTCACACAAACCCATTGAGCTCCATCACCAACA
GTCTGTGACTCTGGGTCGAGGACCAGACACTAAGATAAAA
GACAAGAAGTGCTCTAGAGAACAAGTTGAATTGAGAGCTG
ATTGCAACAGGGGATTTGTCACTGTTAAACAGCTGGGTGT
GAATCCGACACTTGTGGATGATGTGGTTGTGGGCAAAGGC
AATCAGGTGAGCATAAAGCCGGGTCAGAGACTCTACATGG
TCAATCAGCAGTATCCTTACAGTGTGAAGTTCACGGAGGA
CACGTCCAGATCCAAACCCTCCAAAAGAGCCCAGCAGATC
CAGAGCCCTACAAAAACAACAGCAGATGTGTCAGACAGCC
CACCTCCACCCAAAAAAACAACACCACCTGCTGGTGAAAA
ATCGGAGTCTGCTGGGCACTGGAGCCAAGGACTTAAAGCG
TCAATGCAGGACCCCAAAATGCAGGTGTATAAAGACGACA
GCGTGGTGGTAATCAAGGATAAATACCCGAAGGCTCGTTA
TCACTGGTTGGTTTTGCCGTGGCAGTCGATCTCCAGCCTG
AAGGCACTGCGCTCCGAGCACGTGGAGCTGCTCAAACACA
TGCAGCGGGTGGCAGATCAGATGGTGGAGCAATGTCCTGA
TGCCCACAAACTGAGCTTCCGGCTCGGCTACCACGCCATT
CCCAGCATGAGTCACGTTCATCTGCACGTCATCAGTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations