Transcript

gstcd-203

ID
ZDB-TSCRIPT-110912-878
Name
gstcd-203
Previous Names
  • gstcd-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052481 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052481|OTTDARG00000021831|ZDB-GENE-050320-41 gstcd|OTTDARP00000041250 gstcd-003 LG_none BX572104.6,BX537118.12 Danio rerio protein_coding KNOWN, 857 bp
GATTTTAAGCTCTTCATGTGTTCTGCCCTCATCTAGGCTG
TCAAAATGAAGCAAACCGATCCTGAAACGCACAAGGAGAG
CCTCTATCTGGAGGTGTGCGGAGCAAACGGAGCTGTTTCC
CTCCCCCTGCACTCCTCCATCGTCCTCTTCCTCCTGTCCT
ACAGCGAATGCTCATCTTTTCACGTCTGCCTGGTCACAGA
TCAAGCAGACGTCCTGCAGTCCCCGTCAGCTCTGGTGCCC
GCCGGTCTCTCTGTTTCTGCACTGAGGAGGGACGAGCTGC
CAGGCCTGGTTAAGATGTGTCGTCTGCCGGCCGCTCTGGA
GTCTGATGTCGGCTTTTGCCGAGCCGGCCTTGCTGTCGTG
CTCAGACACATCATTCAGAGAGCATGCCAGTTGATGCCCG
ACCGCAGGGACGTGGCGTCACTTTTGGGCTTTAAAAACAC
CTGCCTCAAGGCTTGTGCTGAGGTTAGTCAGTGGACCAGA
CTTTGTGAGCTGGAAATTCCCTCTGCAGTAGAAAAACATT
TACAAAACCCTGAAGATGAGACGAATCGACTTCCTCCTGC
AATTATAAACTTGGAAAAGAGGTTAGGGGAGCCTGTCAAA
GTTCACAACGATGACAAGATACGTCGGCAGAAGCTACAAC
AGCAGAAGAAGAGCGATTCTCAAGTAAAAGATGCCGAAAA
GGAACCCCATCCAAATGTTGAGCTCAGCGCTGCTCTGGCC
AGGCTTTCTACAGATGCAGTTTGTCCTCCATCCAGCAGAG
AGCACTCGGACATCAGGAAAGTCAAGAGCACTGATCTGCC
AGAGCTGGAGCATGTGTTTGCTGAGGGCCTGTATTTCACT
CTGACCGATGTCGTCCT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations