Transcript

gstcd-201

ID
ZDB-TSCRIPT-090929-10469
Name
gstcd-201
Previous Names
  • gstcd-002
  • zgc:110248-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027936 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027936|OTTDARG00000021831|ZDB-GENE-050320-41 gstcd|OTTDARP00000022862 gstcd-002 LG_none BX572104.6,BX537118.12 Danio rerio protein_coding KNOWN, 1345 bp
AATATCCGTTTATACTCGGACTGTTTTTAATGTGAGACCA
ACACAAGTTGCACATGTGCTGCTTCCCAGTGGATATTTTG
CTCAATTCAAACAGCTGTCAAAATGAAGCAAACCGATCCT
GAAACGCACAAGGAGAGCCTCTATCTGGAGGTGTGCGGAG
CAAACGGAGCTGTTTCCCTCCCCCTGCACTCCTCCATCGT
CCTCTTCCTCCTGTCCTACAGCGAATGCTCATCTTTTCAC
GTCTGCCTGGTCACAGATCAAGCAGACGTCCTGCAGTCCC
CGTCAGCTCTGGTGCCCGCCGGTCTCTCTGTTTCTGCACT
GAGGAGGGACGAGCTGCCAGGCCTGGTTAAGATGTGTCGT
CTGCCGGCCGCTCTGGAGTCTGATGTCGGCTTTTGCCGAG
CCGGCCTTGCTGTCGTGCTCAGACACATCATTCAGAGAGC
ATGCCAGTTGATGCCCGACCGCAGGGACGTGGCGTCACTT
TTGGGCTTTAAAAACACCTGCCTCAAGGCTTGTGCTGAGG
TTAGTCAGTGGACCAGACTTTGTGAGCTGGAAATTCCCTC
TGCAGTAGAAAAACATTTACAAAACCCTGAAGATGAGACG
AATCGACTTCCTCCTGCAATTATAAACTTGGAAAAGAGGT
TAGGGGAGCCTGTCAAAGTTCACAACGATGACAAGATACG
TCGGCAGAAGCTACAACAGCAGAAGAAGAGCGATTCTCAA
GTAAAAGATGCCGAAAAGGAACCCCATCCAAATGTTGAGC
TCAGCGCTGCTCTGGCCAGGCTTTCTACAGATGCAGTTTG
TCCTCCATCCAGCAGAGAGCACTCGGACATCAGGAAAGTC
AAGAGCACTGATCTGCCAGAGCTGGAGCATGTGTTTGCTG
AGGGCCTGTATTTCACTCTGACCGATGTCGTCCTGCTGCC
CTGCATCCATCAATACCTGGTAAAAACAAACAAATCGAAA
GCAGTTTTCATCTCATTATGTATAAATCACTATTGCCCAC
TGAGAAATAGCCCGTTGCTCAGTTGTTTTAGCAGTAGAGG
AGACCTTTTTTTAGGTTTCTTTTAGGTTCTGTCAAATATA
GAAGCCTCTTATGCCTTTTTGACTTCTCTGACTTCAAGGT
GATTCTGCTTTAAAGGGATAGTTCACCCTTCAAAAACTCA
CCCTGTTTCCAAGCCTTCATGACATTGCTGCACGATATTA
AGAAAAAATCTGACATTGCAGTAATTGTTTTTTTCTTACA
TATAAGAATCCTGGAAATCTGTAACTATTGACTTCCATTG
TACTTTCTTCAAAATATCTTATTTTGTGTCTGATCAGAAT
AAAGAAACAAAATATGACTGCACAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations