header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110912-817
Transcript Name: mcu-201
Previous Names: mcu-001, ch73-57a19.1-001, zgc:153607-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000052051 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000052051|OTTDARG00000036537|ZDB-GENE-061013-24 mcu|OTTDARP00000040902 mcu-001 LG_none CU856520.12,CU915733.5,CU929204.6,CU633781.7 Danio rerio protein_coding KNOWN, 1323 bp
AGTCGGCTCGCCCGCAGCACTTGCGTCCTCTCGGCCGGGT
TTCACTTCAGAGATGGCTGCGAAAGTGTGTAGATCGGTCC
TCCTCCTGTCCCGGAGCAGCGGAGCCGTAGCCTCCTCGGC
GTATCCCGCATTCGGTGTCTCCTCACAGAGGCATCAGGGC
ACAAAAACGGAGGCGCTGTCCATGTCTCTTGGAGGTCACC
AGACTGTCAGGAGAGCACACGGTCTGAGAACAGGGGGAAG
GTGTGCGCTGTTCTGCCACCCCAGTGCCACTCTGACAGCC
CAGGGCTGGAAGGGCTCCCCCTCATGGCAGGTTCAAAGAC
TATTGTGTTCACCTGCTGCAGAAGATGTCTCAGTGGTGTA
TCACAACGGATTGCCGGTGATTTCTGTACGTCTGCCGTCT
CGACGAGAGCGCTGTCAGTTCACCCTCAAACCTCTGAGTG
ACACGGTGGGTGTTTTCCTTCAGCAGCTGCAGGCGGAGGA
CAGAGGCATCGATAGAGTCACCATCTACTCTGCAGATGGA
GCAAGAATAGCGTCCTCAACAGGGATTGACATTTTACTTA
TGGACAACTTTAAGCTAGTCATTAATGACACCTCATACCT
GGTGCAGCCCCCCAGGAGAGATCTGTTACCGCACGAGGAC
GGCGAGCGGCTGAACGATGTCAAGATTTTGGTGCAGCAGC
TCTACACCACCCTGCGTATAGAGGAGCATCAGCTCAACAA
AGAGAGAGAGCTGATTGGACGACTGGAGGACCTCAACTCT
CAGCTCAAGCCCTTGGAGAAGGTTAAAGAGGAGCTGAGTA
AGAAAGCCGAGCGCAGGACTACCTGGGTGCTGTGGGGGGG
AATGGCTTACATGGCCACGCAATTTGGCATTCTGGCACGG
CTGACCTGGTGGGAGTACTCATGGGATATCATGGAGCCTG
TCACGTATTTCATCACCTACGGCACCGCCATGGCCATGTA
CGCTTACTTCGTGCTAACACGTCAGGAATATCTATACCCG
GACGCCAGGGACAGACAGTACCTGCTGTTCTTTCATCGGG
GAGCAAAGAGGACACGCTTTGACATTGAGAAGTACAACAA
ACTGAAGGATGCCATCGCTGAGGCGGAGTTGGATCTAAAG
CGTCTACGAGACCCGCTGCAGTTGAATCTCCCTATCCAGC
AAATCGATACCAGCAAAGACTGATGAGAATGTGAAGCCCT
TTCAGCCTCTCTCTTTCTTTCTCTCACATTTCTTTCTCCT
CTGCCTTTTAGTTTAGTTTTCTGTCTTTTTTTATTGTTTG
TTTTATTTTTACAGCCTCAATGAAAAAAAAACACATATCC
ACA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mcu-201 Contained in:
[BAC] CH73-57A19 (1) (order this)

OTHER mcu-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000052051 (1)
  • Ensembl_Trans:ENSDART00000165259 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC124705 (1) 1898 bp
    CITATIONS (2)