Transcript

lrp2a-202

ID
ZDB-TSCRIPT-110912-813
Name
lrp2a-202
Previous Names
  • lrp2a-001
  • ottdart00000052037
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052037 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052037|OTTDARG00000036529|ZDB-GENE-050119-2 lrp2a|OTTDARP00000047931 lrp2-001 LG_none FP236164.7,FP102788.4,FP102946.4,BX927361.32 Danio rerio protein_coding KNOWN, 17239 bp
GTTGTGAGTCGGGATTTTTCCGTTGCGGGACGGGCCGGTG
TATTCCAGTCAGTCAGAGATGCGATGGGACAAACGACTGT
TCGGATAACTCAGATGAAATTGGCTGCCCTCAGCCCACCT
GCGAGAGCGCTCAGTTCCAGTGCTTGAGTGACGGCGAGTG
CATTCCTCAGCACTGGGTCTGCGATGATGAGGAAGATTGC
GAAGATGGCTCCGATGAAAGGCAGCACTGCCCTGGCAGGA
CGTGCTCCAGTTCACAGTTCACCTGCACCAACGGGGCCTG
CATCCCTGGAGGATACAGGTGTGACAGAGTGCCCGACTGT
CTGGATGGAGCAGACGAGAGGAACTGCTTTTACCCAGAAT
GCTCGGAGCTGAGGTGCGCTAACGGGGCATGTTTTAATCG
GAGCCAGCGCTGTGACCAGGTGCTCAACTGCCGAGACGGC
TCAGATGAGGCCAACTGCACCCAGCGGTGCAGCAGTGGTC
AGTTTCAGTGCAGTAATGGAGAGTGTATTCCTCGAGGCTA
CATCTGCGATCATGATGACGATTGCGGAGACAGAAGTGAT
GAACAAAACTGCACCTATCCAACCTGCAGAGGCACTTACT
TCACCTGTCCCAGCGGCCGCTGCATCCATCAGGTCTGGCT
GTGTGATGGAGAGGATGACTGCGAGGACAATGCGGACGAG
AAAGGCTGCGATAATGTCCAGCGGGAGTGTTATCCAGGCG
AATGGCCGTGTCCTTCTTCTGGTGTCTGCATCCCTTTTGA
CCACCTCTGTGACGGGACAGTTCACTGTCCTGATGGAGAA
GATGAGACCAACATCACCGCCGGACGCAACTGCAGTATCT
GGCGCTGTGCTTCGCTGAGCTGTGAACATCACTGTCACGC
GTCTCCGGATGGAGGAACCTGTGCTTGTCCACCTGGATAT
GTGATCAACACAAACGACAGCCGCTCCTGCATGGATTATG
ATGACTGCAGTCTGTGGGGAATGTGTGATCAGCTGTGTGA
GGATCGCATCGGGAGTCATCGCTGCAGCTGTCGGGACGGC
TACATTCTGGAGCAGCACAGATACTGCAGAGCAAATCCCT
CATCTGGCGTGCCCTCGCTTATATTCTCCAACGGCAGAGA
CCTGCTGATCGCTGATGTTCATGGACACGGCTCTCAAACA
CTGGTTCAGTCCCAGAACAGAGGAGCCGCTGTTGGTGTGG
ATTTTCATTACCAGCTGCAAAGGGTCTTTTGGACGGACAC
AATCCAAAATAAGGTGTTTTCTGTGGATATGGACGGCTCG
CGTCTGCAGGTGGTGCTGAACGTGTCGGTGGACTATCCCG
AAAATCTGGCCGTGGACTGGGTGAACAATAAGCTGTATGT
AGTGGAGGCCAGTGTCAACAGGATCGACATGGTGGACCTG
GACGGCAGCAATCGGGTCACGCTGATCGCAGAGCACCTGG
GAAACCCAAGAGGACTCGCGCTCGACCCGACCGTAGGGTA
TCTTTTCTTCTCTGACTGGGACACTCTGAATGGAGAGCCC
GGTTTGGAAAGAGCCTACATGGACGGCACCAATCGCTATG
GGATCATCAGGACCAAACTCGGCTGGCCTGCAGGAATCAC
TCTGGACCTCGAGGCCAAAAGAGTGTATTGGGTGGACAGT
CGATATGATTACATCGAAACCACAACTTATGATGGGCTCC
ACAGGAAAACAGTAGTTCATGGTGGTTCTGTGATTCCTCA
TCCGTTTGGCATTACTCTGTTTGAGCATTCAGTTTATTAC
ACTGACTGGACTAAGATGGCTGTCATGAAGGCTAATAAAT
ACAGCGACAGCAACCCACAAGAGCTCTACAGGACCACACA
GAGACCATATGGCCTGACCGTTGTACATTCATACAAACAG
CCATTTGTCAGTAACCCGTGCGGTGCTGATCGAGGGGGCT
GTGAGCACATCTGCGTTCTGAGTCACAGAACTGATAACGG
TGGTCTGGGATATCGCTGCCGCTGCCGAATGGGTTATGAT
CTGCACGCTGACGGCAAGAGATGCGTTGCTGTAAGGCAGT
TTCTGCTGTTCTCCAGTCAGCTGGCGGTCCGAGGAATCCC
CTTCAATCTGTCCACACAGGAGGACATCATTCTGCCCATC
ACAGGAACGCCGTCTTATTTTGTGGGAGTGGACTTCAGTG
CTGAGGATAATTCAATATTCTTCTCTGATACAGTAAAAGA
CATCATCTACAAACAGAAAGTTGATGGAACTGGTCGAGAG
GTTTTGGCAGCCAATCGGGTGGACGGAGTGGAAGATCTGG
CATATGATTGGATATCGAAGAACTTATACTGGACGGATCC
ACGTTACAGGAGTATTTCTGTGATGAAGGTGGTGGATAAA
TCCAGACGAGCCATCGTACGCAACCTTAACAACCCCAGAT
CCATAGTGGTCCATCCAGTGGCTGGGTTTATATTCTGGAC
TGACTGGTATCGTCCTGCGAAGATCATGCGGGCCTGGGGT
GATGGTTCACATGCTCAGTCTATAGTGAACACCACTCTCG
GCTGGCCCAACGGCCTGGCCATAGACTGGAGTGCCATGCG
CTTGTATTGGGTGGACGCCTTCTTTGATAAGATCGAGCAC
AGCAACTTTGATGGACAGAACCGGTTGTCTTTGGACCGAA
TCACTCAGATCTCACACCCGTTTGGGCTCACTGTTTTTGG
AGGTTACGTGTACTTCACTGACTGGCGGCTGGGAGGAATC
GTGAGGGTCCGTAAAACAGATGGAGGAGAGATGATGACCA
TTCGTCGAGGGATCAGCCACATCATGCATGTCAAATCATT
CAATGCCGACTCACAAATTGGGTTTAACTTCTGCAGCCGG
CAAACTAACCCAAATGGAGACTGCAGTCACTTTTGTTTCC
CTGCACCAAACTCCCAAAGAGTGTGTGGCTGTCCGTATGG
AATGAAGCTGGAAGCCAATCAGCAGACGTGTGTTGACGAT
CCGTCAAACGAGCCGCCGACTCTCCAGTGCGGCTCCAACT
CTTTCTCATGCTCAAACGGGAAATGCGTCCCACACAGCTA
CCAATGTGACGGCGTCGATGACTGTCACGATAACAGTGAC
GAAGCACACTGCGGCGCTCATAATAACACTTGCTCGCCCC
TTGCCTTCACCTGTGCCAATCAGCGATGTGTGCCCAGAAG
CTGGCACTGCGACGGACACAATGACTGTTTTGATGGCAGT
GACGAGAGGGACTGTCCCACTCAGACCCCTGGCACATGTC
CGGCAGACCAGTTCATCTGTGCCAACCATTACTGCATCCC
TCGCACTTGGCTCTGTGACACCGACAACGACTGCGGAGAT
GGATCAGACGAAAACAACTGCGATTCGATTGGCACGTGTT
ACCCTGGTCAGTTCCAGTGTCCAGACCATCGCTGCATCGA
CCCTAATTATGTGTGTGATGGAGACAGAGATTGTGCTGAT
GGTGCAGATGAACAAGGCTGTGTGTACAACTGCACAGCCT
ATGAGTTTAAGTGTGCAAACGGCCATCAGTGTGTGAACTC
GTACTACAGATGTGACGGCGTTTTTGACTGCAATGACCGC
TCTGATGAATCTGGTTGTCCCACTAGGCCTCCGGGCATGT
GCCACCATGAGAGTGAGTTTCAGTGCCAGTCAGATGGCAG
CTGTGTGCCAGTGAATTGGGAATGTGACGGTCATCCGGAC
TGTGAGGACGGTTCAGACGAGCATCACGCGTGTCCACCGC
GCACCTGTCCCACCACGCAGTTCCGCTGCGACAACGGCAA
CTGTGTTTACCGTGGCTGGATCTGCGATGGAGATAACGAC
TGTCGGGATGGGAGCGACGAGCGGGACTGTCCCACACCAC
CGTTTCGCTGTCCCAGCTGGCAGTGGCAGTGTCCCGGGCA
TAGCGTGTGTGTGAACCTCAGCAGGGTGTGTGACAACACT
CCAGATTGTCCCAACGGAGCCGACGAGTCCCCGCTTTGCA
ATGAGCCTTTGCCAGATCAGGAGAGCTGCTCTGACAATAA
TGCGGGCTGCACTCACGGCTGCATCCAGGGCCCGTTCGGA
GCCCAGTGCACGTGTCCCATGGGCTTCCAGCTGAGCAATG
ACTCGAAGACGTGTGAGGACATTGATGAATGTCACCCGCC
GGGCGTCTGCAGCCAACACTGCTTCAACGAGAGAGGCTCC
TTCCGCTGCCACTGTCAGGATGGATACACGCTGGAGGCAG
ACGCACGCACATGCAAAGCCTCAGGATCTCGAGAGGCCTT
GCTCTTAGTGGCCAGTCGGAATCAGATTATATCCGACGAC
ATCCTCGCCCAGCCCAACGCTATTCGCTCTCTAGTGCGAG
ACGGTCGTAACATCGTAGCGGTGGATTTCGACTCAGTCAC
TGAGCGTATTTACTGGTCCGACACCACGCAGGACAGGATA
TGGAGTGCTCACAAAAACGGGACTGACCGCACAGTGATCT
TTGACAGTGGAGTGACCGTCACTGAGAGTCTTGCCGTCGA
CTGGGTTGGCAGAAACCTGTACTGGACTGACTACATTCTG
GAGACCATTGAGGTGTCCAAACTGGACGGCTCCCACAGAA
CGGTGCTGATCAGTGAAAATGTGACGAACCCTAGGGGTCT
GGTAGTGGACCCTAGAAACAACACTCACCTGATGTTTTGG
ACTGACTGGGGCAGAAATCCTCGTATTGAGAGAGCCAGTA
TGGATGGCAAGTTAAGGACCACAATCATCAGCAACAAACT
CTACTGGCCCAATGGATTGACGATTGACTACCCCAACAGT
CTACTATACTTCGCTGACGCTTATCTAGACTTTATAGACT
ACTGCGATTACGATGGAAAGAACCGAAAACAAGTACTGGC
CAGTGATTTGGTACTGCAACATCCCCACGCAATTACCATT
TTTGAGGATTTTGTCTATTGGACCGACAGATACGTCAACC
GCGTGATCCGGGCCAACAAGTGGCACGGACAGAACCAGTC
GGTGATGCTGTATAATCTGCCCCAGCCAATGGGTCTGGTG
GCACTTCACCCTGCTAGACAGCCAGCAGGTTATAACCCAT
GTGATCCTCATTCAAGCCCCTGCACTCATATCTGCCTGCT
GTCAGCAGTCGGTCCCAGGTTTTACTCCTGTGCCTGTCCG
TCTGGCTGGACTCTCGCCGCTGACCAGTTCACATGTGCTA
GAGTTGAGGATCCTTTCCTGGTGGTAGTGAGAGACAGCAT
TATTTATGGCATCCCACTCAACCCTAACGACAAGAGCAAT
GATGCCATGGTGCCAGTCGCTGGGCTGCTGAATGGATACG
ATGTTGACTTTGATGATGCTGAGCAGATGATCTACTGGGT
GGAACATCCGGGGGAGATTCATCGGGTGAAGTCAGATGGT
ACCAACAGAACTGAGTTCGCACCAGCAGCTATTTTGGGGT
CTCCAGTGGGTCTGGCTCTGGATTGGATGTCTCAAAACCT
GTACTACTCCAACCCTTCATCACAGGCTATAGAGGTTCTA
AGGCTTAAAGGAGAAATTCAGTACAGAAAAACCCTCATCA
CGAACAACGGCTCACCTACAGGCGCAGGAGCTCCCGTTGG
CATTGCGGTGGATCCGGCACGTGGAAAGATGTACTGGACT
GATCATGGAACAGAGAGCGGGATCCCGGCTAAGGTGGCAT
CAGCAGATATGGACGGCTCCAACGCGGCCATCCTCTTCAC
ACATAATCTAGAACATGTGGAGTTTATAACCATAGACATC
ACAGAGAACAAACTTTACTGGGCCGTCACAGGGACTGGTG
TGATTGAACGCGGTGACCCTGACGGATCAAACCGGATTAC
CATGGTAAACGGACTGTCCCATCCCTGGGGTGTGGCGGTG
TACGGCTCCTACCTGTACTTCACTGATCGAGACTTTGAAG
TGATTGAACGCGTGGATAAAGCCACAGGACTCAACCGGGT
CGTAATGCGGGATAACGTGGCTGGTCTCAGAGTACTCAAA
GTACACCACAGAGACTCGTCAGCCGGCTCATCTAACGGTT
GCAGTAATAATGTGGGCACGTGTGAGCAGTTGTGTCTCCC
TCGTCCTGGTGGTCTGTTCAGCTGCGCCTGTGCGACCGGG
TTCAAACTCAGTGCTGATAACCGGACCTGTTCTCCATACC
AGTCATACGTGGTGATCTCTATGCTCACTGCCATCAAAGG
CTTCAGTCTGGAGGGAGTGGATCACTCCGAGTCTATGGTG
CCTGTAGCTGGAAGAGGCCGCAATGCTCTTCATGTAGACG
TGCACATGGCCTCAAGTTTCATCTACTGGTGTGACTTTAG
CAGCACAGTAGCGTCCCAGAATGGCATCCGCAGGATTAAA
CCGGATGGATCTGGATTTCGCAGCATCGTCACCTCTGGAA
TCGGACGAAACGGCATACGGGGCATTGCAGTAGACTGGGC
TGCAGGAAACCTCTACTTCACCAATGCCTTCCTGACCGAG
ACGTACATCGAAGTCATTCGGCTCAATACCACTTTCCGCC
GTGTCCTTCTCAAGACCCAAGTAGACATGCCTCGTCATAT
TGTGGTGGATCCTAAAAACAGATACCTCTTCTGGGCTGAC
TATGGACAGACCCCCAAAATCGAGCGAGCATTTCTAGATG
GCTCCAACCGGACAGCTCTGGTTTCCTCTGGCATCGTCAC
CCCCAGAGGTCTTGCTCTGGACCACCGAGACGGATACATC
TACTGGGTGGATGATTCCTTGGATATGATTGCACGAGTTC
GGCCTGAAGGGGGCGAAACGGAGGTCGTCCGTTACGGAAG
CCGCTATCCGACTCCGTATGGCATCACTGTGTTTGAAGGA
AATGTAATCTGGGTGGACAGAAACCTCAAGAAAGTCTTTC
GAGCAAGCAAACAGCCTGGTGCCACCGACCAGCCAGCCGT
GATCCGAGACAACATCAACATGCTGCGGGACGTCACCATT
TTTGACCGCAGAATGCAGCCAAGTTCAGCCCATGAGCTCA
ATAACAACCCCTGCTTAGAGTCGAATGGAGGCTGTGCTCA
TTTCTGCTTTGCCATGGCAGGAGCTCAGACCAGGAAATGT
TCGTGTGCTTTTGGGAATCTGGCTGCGGATGACAGCAGCT
GTGTGGTATCCCGGGATGACTACCTCATTTATACTACAGA
AAGCACCGTGCGCTCTCTGCGACTGGACCCAGACGATCAT
TCGCTGCCCTTTCCTGTAGTAAACGTGCCCCGGACTTCGG
TGGCGCTTGATTTCGACCGCTTGGATGGCAGGATCTATTT
CACCCAGAGCTCGGGAGCAGGCCAGAGCAAGATTAGCTTC
ATTACTTTGGCTTCGCCTACCTCTCCCGCTACTGAGGTGG
CCTCAGATCTGGGAGCTCCTGACGGCATCGCCTATGACTG
GATTAACAGGAGGATCTATTACAGTGACTACATTAACCAG
ACTATCAGCTCTATGGCAGTGGATGGATCTCAGAGGACTG
TTGTGGCGCAGGTGCCCAGACCCAGAGCCATCATGCTGGA
TCCGTGTAGAGGGTATATGTACTGGACAGACTGGGGAACC
AGTGCAAAGATAGAGCGCGCAACTCTCGGAGGAAACTTCA
GGACAGAGATTGTCAACACCAGTCTAGTTTGGCCAAATGG
TTTGACGCTGGACTATGATGATCAGAGGCTCTACTGGGCA
GATGCCAGCTTACAGAAGATTGAGAGGTGCTCGCTCACCG
GCACTAACCGTGAGGTCATTGTAAGCACCGCCATTTACCC
ATTTGCAATGACAGTTTATGATCAGCATATCTACTGGACG
GACTGGAACACGCGCAGCATCTACCGCGCAAACAAGCACG
ACGGGTCTGATCAGAGGGTGATGCTACAAAATCTTCCATC
TCGACCCATGGACATCCACGTCTTATCTAACAGCAAACAG
CAGCAGTGCAGCAGTCCCTGCGAACAGTTCAACGGTGGAT
GCAGCCACATTTGCACTCCAGGTCCTCAGGGAGCAGAGTG
TCAGTGTCCTTCAGAGGGCCGCTGGTATCTGGCCGACAAC
AAACACTGTATTCCTGACAATGGCACGCGCTGCCAGCCCG
GGCAGTTTACTTGCATGAATGGCCGCTGTATCCGCTCACA
GTGGAAATGCGACAATGATGATGACTGTGGAGATGGCAGT
GATGAACTGGAAAGGGTCTGCGGATCCAAACATCATTTTG
TTTTTGTCCGACAAGCAGCAGCCTTTATTTCTCTCTCAGC
ATTTCACACCTGCGAGCCCACAGTGTTCACCTGTGGAAAT
GGTCGCTGTGTGCCGTATCATTACCGATGCGATCACTACA
ATGACTGCGGGGATAACAGCGATGAGACTGGCTGCATCTT
CAGACCCTGCGACCCAAATACAGAGTTCTCCTGTAATAAT
GGCCGCTGCATTGCCAGGGAATACATCTGCAATGGAATAA
ACAATTGCTACGATAATGGGACCTCGGATGAACAGAACTG
CCCTGAGAGGACTTGCCAGCCAGAACACACCAAATGCCAG
TCGACTAATATCTGCATCCCGCGCTCGTATCTATGTGATG
GAGATAATGACTGCGGAGACAACAGTGACGAGAGTCCCAC
ACACTGCGCCACATCTACATGCTCCCACAATGAGTTCCGC
TGCTCGAGTGGACGCTGTATTCCTGGCCACTGGTACTGTG
ATGGAGGAACAGACTGTAATGATGGATCTGATGAGCCCAT
TACCTGTACCTCTCTGGTAAGGACCTGCAACTCTGAGCAG
TTTCGCTGCGATGACGGACGCTGCATCGCCTCCTCCTGGA
TCTGTGATGGAGACAACGACTGCGGAGACATGAGCGACGA
GGACCAGAGACACAACTGTGCGAACCGCACGTGCTCAGCT
CAGGAGTTCACCTGTGTGAATAACAGGCCTCCTCAGAGGA
AGTGTATCCCGCGGGACTGGGTGTGTGACGGAGATGCTGA
CTGTTCAGACGCCTTCGATGAGCACCAGAACTGCACCCGC
AGGTCCTGCTCCACCAATGAGTTCACCTGCAACAACGGCC
TCTGCATCCGCAGCTCATACAGGTGTGATCGGCGTAATGA
CTGTGGAGACAGCAGTGATGAGCAGGGCTGCACCTATCAG
CCGTGTCAGCAGCATCAGTTCACCTGTCAGAACGGCCGCT
GCATCTCCAGGGATTTCCTCTGTGATGGAGATAACGACTG
CGGGGACGAGTCTGATGAGCTGGACCACCTGTGCAGGATG
CCTGCGCCCACCTGCCCATCCGGACACTTCCGCTGCGACA
ACGGCAACTGTGTGCCGCAGAGCCAAGTGTGTGATAGAAA
TGACGACTGCAGCGACAACAGCGACGAGAAGGGCTGCGGC
ATTAACGAATGCACAGACCCATCAATGCACCACTGTGACC
ACAACTGCACCGACACACTGACCAGCTTCATCTGCACCTG
TCGGCCCGGCTACCGCCTCATGTCTGACAACAAAACCTGC
GACGACATCGACGAGTGCTCTGTCACACCCAGCGTCTGCA
GTCAGGTCTGCGAAAACACCCTGGGCTCATACGTCTGCAA
ATGTGCTCCGGGATTCCTCCGTGAACCAGATGGTCACAGC
TGCAGACAAAACAGCAACATCCACCCGTATTTAATCTTTA
GCAACCGCTACTACCTGCGCAATCTGTCCACGGACGGAGA
GGCCTATTCGCTCATCCTGCAGGGTCTGAGTAGCGTGGTG
GCTCTGGATTTCGACCGCGTGGATAAACGCTTGTATTGGA
TCGATGTGAGCCGCAGAGTGCTGGAGCGAATGTTTTTTAA
CGGGACAGGCCGGGAGGCGGTGGTCAATGGGGTTTTGCAT
GGTGAAGGGCTGGCGGTCGACTGGATTGGGAGGAAGCTTT
ATTGGGTGGACAGTTTTCTGGATTGTCTGAAAGTGTCAGA
GCTGGACGGACGCTTCGTGAGGAAGTTAGCTGAACACTGC
GTCGATGATAATCACACATACTGCTTCCAAAATCCCAGAG
CCGTCGTGCTGCATCCCAAATTTGGGTATGTGTACTGGAC
TGACTGGGGAGAAAGAGCGTTCATTGGTCGTGTTGGAATG
GATGGAAATAACAAGTCTGCCATCATCACTACCAAGATCG
AGTGGCCAAATGGTCTGACCATCGACTACACCAACGACAA
ACTCTACTGGTCTGATGCTCATCTCAACTACATTGAGTTC
TCAGATCTGGATGGGCGTCACAGACACACAGTGTATGATG
GTGTTCTGCCTCATCCGTTTGCCATCACAGTTTTCGAGGA
CACCCTTTACTGGACTGACTGGAACACTCGAACGGTGGAG
AAGGGCAACAAATACAATGGCTCTGGACGTGAGATGCTGG
TCAACACCACACACCGACCTTTCGACATCCACGTATGTCA
CCCTTACCGTCAGCCTATAGTGACGAACCCTTGTGCACTT
AATAATGGAGGCTGTTCTCACCTGTGTCTCCTGCGGGCTG
GAGGTCAGGGGTACACCTGCGAGTGTCCGGATCACTTCCT
GACGGTGCAGATCGCCGGTGTTGCGCGCTGTTTACCCATG
TGCTCAAGCACACAGTACAGATGCGCAGACAATGAACGTT
GTATCCCGATCTGGTGGAAGTGTGACGGTCAGCGGGACTG
TAGAGACGGGTCAGATGAACCCTCCACGTGTCCCGTCCGG
CACTGCAGGCTCGGTCAGTTCCAGTGTAATGATGGAAACT
GCACCAGTCCACACTTCCTCTGCAACTCCAATCAGGACTG
TCCCGACGGCTCCGATGAGGACACTGTGCTCTGTGCCACT
CATCAGTGTGAGTCTCATCAGTGGCAATGTGCCAACAAGC
GCTGCATCTCTGAGGCCTGGCAGTGTGATGGAGAGAACGA
CTGCGGCGACGGCTCCGATGAAGATCCCGCTCACTGCTCC
AGCCGCACCTGCAGACCAGGACAGTTCAAGTGCAGGAACG
GACGCTGCATCCCCAATACCTGGAAGTGTGACGTGGATGA
CGACTGTGGAGACAACTCTGACGAACCCATCGAAGAGTGC
ATGGGTCCGGCGTACAGATGTGACAATCACACAGAGTTTG
ACTGCAGGACGAACTACCGCTGTGTTCCTCTGTGGGCCGT
GTGTAATGGACACAACGACTGCAGAGACAACAGTGATGAA
CAGAACTGCGAGGAGTTGACGTGTGAGCCGTCAGGGGATT
TTCGCTGTGATAACCACCAGTGTATCCCGCTGCGCTGGCG
CTGTGACGGAGACAACGACTGCGGCGACGGTTCAGACGAG
CTCAACTGCTCTCCTCGTCCGTGCACAGAGAGCGAGTACC
GCTGCGACAACCTGCACTGCATTCCTGACCGCTGGGTTTG
TGACCATGACAATGACTGCGAGGACAATTCAGACGAGAGA
GACTGCGAGCTGCGGACCTGCCACCCGGGTTACTTCCAGT
GTGCGAGTGGACACTGCATCGCTGAGCGCTTTAAATGCGA
CGGCAACGCTGACTGTCTTGACTTCACTGATGAAAGTTCC
TGTCCCACACGCTACCCGAACAGCACCTACTGTCCACCCT
TCCTGTTTGAGTGTAAGAACCATGTGTGTGTGCAGCAGCA
CTGGATATGTGATGGAGATAATGACTGCGGGGACAATTCA
GATGAGGAGCTGCATCTCTGCTTGGACATCTCATGTGATC
CTCCTTTCCGTTTCCGCTGTGATAACAACCGCTGCATCTA
CAGTCATGAGGTCTGCAACTCTATAGATGACTGCGGTGAT
GGAACAGACGAGAGGGCGGAGCATTGCGTGACTCCCACAC
ATGGGCCCTGCTCTGCAGACGAATATAAATGCGGGAACGG
TCAGTGTATTCCTCTACAGTACGCCTGTGATGACTACGAT
GACTGTGAAGATCAGAGCGATGAGCTTGGCTGCTACTTCG
GCCACGGACGGTCATGCAGTGAAAACCTATGTGAGCATAA
CTGTACGGATTTGTCAGCCGGAGGCTTCATTTGCTCTTGT
AGACCTGGATATAAACCTAACCCGGAGGACAAGAATACCT
GCGAAGATGTGGATGAGTGTGAGATTTACGGCACGTGTCC
TCAGCTGTGCAAAAACACTAAGGGCAGCTATGAGTGTTTC
TGCGCTGAAGGGTTTAGATCAGTCGGAGAGCAGCCAGGAG
TCGAATGCGCCGCTGAGGGAAACCCTCCAGTGTTGTTGTT
GCCTGATAATGTGCGAATCCGCCGCTTTAACTTGTCGTCA
GCGCAGTATTCAGATTATGTGGATAACGCTGAGCACATTC
AGGCTCTGGACTACCTGTGGGACCCAGAAGGCCTCGGTCT
CAGTATCGTCTACTGGACAGTGTTGGGTCGTGGCTCTGAT
TTTGGCTCCATAAAGAGGGCCTACATGACCACGTTTGATG
ACCATGGCAATAATCCAGTGAAGGAGGTGGACCTGAACCT
CAGATACGTCTCCAGTCCGGACGGCATTGCTGTCGACTGG
ATCGGACGTCATATATACTGGACGGACGCTGGAACAAACA
GAATTGAAGTGGCCAAACTGGATGGACGTTACAGAAAGTG
GTTGATTCACAATGATCTCGATCAGCCGGCTGCTATTGTG
GTCAATCCCAGTCTCGGTAAGATGTTCTGGACGGACTGGG
GCAGAAAGCCGAGGATCGAGACCGCATGGATGGACGGTCA
ACAAAGAGAAGTGCTTCTGGATGAAGATCTGGGCTGGCCT
ACAGGCTTGGCTCTAGACTACCTAAATGAAAACCGCATCT
ACTGGTGTGACTCAAAAGAGAACATCATCGAGTCGATGAA
AGTGGACGGGTCCGACCGGCAGATCATTATATCTGGAGAC
ATCGGCCACCCCTACAGTCTGGATGTGTTCGAGGGCCACG
TTTACTGGACGACTAAAGAGAAGGGAGAAGTGTGGAAGAA
AGATAAGTTCGGGAAAGGAGACAAGGTGAAAGTGTTGACT
ATAAACCCCTGGCTGACCCAAGTGAGAATCTACCAGGAGC
ATCGACACAACCACTCAGTGATGAACCCATGTCAGGACGC
CTGCAGTCACCTGTGCCTCCTGCGTCCGGGTGGATTCACC
TGTGCCTGTCCGCAGGGATCAACACTGCTCACCTTCAACA
AAAACCAGTGCGACGCCGCCATTGAGGCCGAGGTGTCCAT
GCCGCTTGCATGCAGATGCATGAATGGAGGAACGTGCTTC
ACTGATGAAGGAGGCCTGCCCAAGTGCAAGTGTCCGTACG
GTTACTCTGGTAGTTACTGTGAAATGGGCAAGTCTAGAGG
AGCTCCCGCTGGCACAGCGGTGACGGTACTGTTAGCAGTG
GTGATTATTCTGGTGACTGGAGCTCTGGTTGTGGGAGTTT
TCCTCAACTACAGGAGAACTGGATCTCTCATCCCGTCAAT
GCCTAAACTACCCAGTCTGAGCAGTCTGGTGAAGTCTGGA
GATACGGGGAATGGAGTGTCCTTTCATTCGGGTGATAATG
TGACCATGGATCTGGAGCCGCAGACTCTCGGGGTGTCCTT
CATTGACAGGGCTATGCAGCTGGATGAGAATTTTGCAGAC
CCTGGACGACAGCCAATTACGTTTGAAAATCCTCTGTACT
CGACTGCAGCCGCTCCGTCCAGTGATCCTGCAGTAATACA
CGCTACACAGGTCACTGTGAACGTCAGTGCGGACCAGGTG
GACAATAACTTCTCAAACCCCACATATCAGCAGGCAGTGG
AGGTGAAGAGCGAACAAGTAGAGGAGAAAAACACACAGGA
GTCCAAATGGAGTTTCTTTAAAAGAAAACTGAAGCCAAGC
ACAACATTTGAAAACCCTACTTATTCAGAGATGCAGGATG
AGCAGACTCCCGGAGCAGCAGACAGCAGCTCTACAGCAGA
GCCGTCTCCGTTTGTTCCTCCCAAACCTCCCAAACGAGAG
AAACTGAGCACATTTACACCCACAGAGGACACTTTCAGAG
ACACGGCCAACCTGGTGAAAGAGGACAGTGACATATGACA
CTCACACACACTCACGGGAAATACAAAGACACACTCCCTT
TGCACAGAATCTATTTTTATATGCAGCCTGCATACGACAG
AAATCAAATGAAGATTATTTTTGAAACAGAAAAAAAAGAA
CCTATAGATGAGAATAGATGAAATATTTGTATAGCCGACA
GACAGAAAAGAGACTTTGCCTTCTGATACGTTGTATGCCA
AGTCATGTTGTATGATTCTTTTTTATTATTATTATTATTA
TTATTGTGACGTCGTATTTGTATATCTTTGCACTGATGCT
GCTGAAGGAGAATGTTATTGAATATTTTGTACATTTGTAA
ATTGAGAAGATTTTTTTTTGTTTGTTTTTTGGGTTTGATA
AGTATCAGACATTATTATGAAATAGATTATTACTTATTCC
TGGAGATTCACACACAGAGACACATGTATATGCCAAGAAT
ACGGAGTAAAAGTGCTTTGAGAGCCGACTGAGACTTCTGC
CGTTTGATCTGATTATTTTTAATAATGTTTTTTTTTTACA
CTATCTGACGAAAGTCTTGTCGCATATCCAAGTTTTTGGA
ACAACAAATATTAACTTGACTTCTAGTTTATCATTCAGTA
TCAGAAGTGGCTTATATGAAAGGCAAAGGCCTCTAGATTT
CGCTTATTTTAACAAAACAAAATATGATCATGTCTTGATT
TTTAATGATTTAATTAGGGCAGTAAGGTCTGACTTTGCTT
AGACAAAAGTCTTATCACTTAACAGAAATAATGTCCAGTA
TAGAATAAGTCATGGTGCAGTGGAAACTGAATACTGTGTA
TGACTCCCTTGAGCTTGGAGGACTGCATCCATACATCTCT
GCAATGACTCAAATCACTTATTAATAAAGTCATCTGGAAT
GGCAAAGAAAGCGTTCCTCCAGGACTCCCAGAGTTCATTA
ATAATCTTTGGGTTCATCTTAATCCCTTCTTCATCTGACC
CCAGACATGCTCAATAATGTTCATGTCTGGTGACTGGGCT
GGCCAATCCAGCTGCACCTTGACCTTCTTTGCTTTTAAGA
ACTTTGATGTGGAGGCTGAAGTATGATGCTGCGTTCACAC
CAGACGTGGAACGCGCGTCAAGCGCAAGTGATTTACATGT
TGTCAATACAAACGCGCGAATTGATATCCTGCGGCGCGAT
GCGAATGACGTGAAATGCCCGAATGGCATGGTGCGAATGG
CACAATACGTGCGAATGCCGGGATACGTGCGAATTGAGCA
TTTTGGCGTTGAATGGACTCAACGCGCGTTTTGCGCAAAT
CACTCTAATTCGAAAATCTGAACTTCAGCGGACATTCGTG
CCTTGTTAACCAATCAGGAGCTTGCTCTTATGGGGGGCGT
GATTATGACGTGTTGCCTGCTGTAGGTGTCCCGGGGGAAA
TCCTCCAGCCAACAAAAACAAAAACTGGGCTCGGCTCAGT
CAGAAGCACAGTTGAAAGCCTCCGTCAACCAGGTACATTT
TTCTGGAGGAGTTTATGAGGTAAAAGAGCTGGATGCACCT
CTGAAAGAATCTAGTGGACTCCAACACGGTCCTAATTGTA
TCGACGCTGTTTTTTTATCCTTCCTAAAGCACATAAACAC
TGTTATTTTCTTCATAAAATCCATGTTAGCCATTTAGCAA
CAAAGCTAGAGTCACCGGGCAGACAGAAGCCCTGCCCATC
ACGCGAATCTGCATCTGTTCTGAAGTTAATTTGACACGCG
AATGAAGCGGGGTTTAACGCGCGAATGAAGCAAGTAAAAT
CAAATGTTCACTTGGCTATTTACGTGCGAATAGCGCGATT
CATCTGCGCATTCCACATCTGGTGTGAACACAGCATTAGA
AGGAGGGCTATCTTGCTGGAGAATTCACCCTCTCCTGTGG
TTTGTAATGTGATGGGCAGCACAAATGTCTTGATACCTCA
GACTGTTGATGTTGCCATCCACTTTGCAGATCTCTCGCAC
ACCCCCATACTGAATGTAACTCCAAACCATGATTTTTCCT
TCACCAAACTTGACTGATTTCTGTGAGAATCTTGTGTCCA
TGCAGGTTCCAATAGGTCTTTTGCAGTATTTGTGATAATT
GAATCAACCTTCTGCCACTTTTCCAAATGATCAACTTAAA
ATTTGTTGCTCTTACAACTGGGATCGACGACAAGACTTTT
GTCAGGTAGTGTACATTTCATACTGTATGTAACTATACCT
CATCTGTCTTGACTGAAGAAAAATAGCAAAACCCTACAAT
ATGAAGGAAATATCAATCATGTGATGATCAACTGAGTGAT
ATTAAAGCAATGGTAAAAAAACAATATGAATAAAAATGGT
CAATATTTACTCACCCGCTCCAGAAAAGCATAAAATCATG
CTGTCTACAGCTATAGAGTATATACAGTAGGTGGTTATAG
TGGTTAGCACCTCACAGCAAGAAGGTCGCTGGTTCGAGTC
CCAGCTGGATCAGTAGCCATTTCTGTGTGGAGTTTGCATG
TTCTCCCCGTGTTGGCGTGGGTTTCCTCCAGATGCTCCGG
TTTTCTCACAGTCCAAAGACATGCGGTACAGGTGAATTAA
ATCGACTAAATTGGCCATAGGTGTATGAGCGTACATGAGT
GTGTATGGGTGTTCCCCAGTACTGGGTTGCAGCTGGAAGG
GCATTCGCTGTGTAAAGTTGGATAAGTTGGGAATAAAGGG
AATAAGTCAAAAAGGTAATGAATGAATGAATACAAAAGCT
TTCAATGAAATGATGGTGAGGAAATAATGTCAGAAATGAT
TCAAATGCATGATCCAGAGGAAGAGACTCTGATTAAAGAA
AGTCTGAAATGATACTAATGCAGTGACATAAACACTTCAG
GATAGAATCTGAAGGCTTCTAAACTTCTGTTTATATATTT
GATTGATACTTGACATTGCCCTGTTTACTTTCTGATTATG
AATATATCCTGTTTCTGTGACCTGGGCTGAAGATTTTTCA
TATTTACTTTCCTGTATGATGAAGTTGATAGTAGTAAAAT
CACTTTCTTTTAAATGATTCTATATATGTATATATATGAT
AATGTATATTATTCCTGCATATGTGACTATAGAAAATACT
AAAGGCAAATTAACGCTGCTGTGAAAAGAAAATCGAATAA
TTTTTATTATTTTTTATTTTTTGGAAAATGTGAAACATTT
TGTGTAAATGTTTCTTTTAAAAGAAAAAAAAATCTCTTAA
ATTAATATGAAAAATACTTAGATCTCAAACAAATAATTGA
CACTTTTTTGAGTGCAAGTAAAGCAATATCTTGAATGTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations