Transcript

ottdart00000051936

ID
ZDB-TSCRIPT-110912-491
Name
ottdart00000051936
Previous Names
  • ch73-335m24.2-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000051936 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000051936|OTTDARG00000036477|ZDB-GENE-100922-203 si:ch73-335m24.2|no_translation CH73-335M24.2-002 LG_ FP016208.12 Danio rerio protein_coding NOVEL, 370 bp
CTTCTCCTAGTGAAAAATCACAGCAGTTCGTAATGTACGC
TGGGCACTATGCCTCCATGGAGCTCTTGTTGGTCCTGGTG
TTTCCTCTTCGTCGTTCTTGCTGTCAACACTCGGCAAACC
TCGTCAGCTCCAGATTTTACTGATTACCTGCACAGGATCC
TGAAGAACCACACTGCTCATGCCTGTGATGGAGAGACTCT
GTCCATCAGATGTCCCTCTAGAACATCAGTGACTGTGCTC
TCTGCGTTTTATGGCCGACGCGTCCCAAGTCCATATCTAT
GCCCATACACAAACCTAAACATGACAGAGGAGAACACTGA
CTGTGCATCAACCACAGCCATTCAGGTAGACTGTATTTGA
TCAGCATTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations