Transcript

si:ch73-335m24.2-201

ID
ZDB-TSCRIPT-110912-191
Name
si:ch73-335m24.2-201
Previous Names
  • ch73-335m24.2-001
  • ottdart00000051935
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000051935 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000051935|OTTDARG00000036477|ZDB-GENE-100922-203 si:ch73-335m24.2|OTTDARP00000047781 CH73-335M24.2-001 LG_ FP016208.12 Danio rerio protein_coding NOVEL, 1369 bp
CTTCTCCTAGTGAAAAATCACAGCAGTTCGTAATGTACGC
TGGGCACTATGCCTCCATGGAGCTCTTGTTGGTCCTGGTG
TTTCCTCTTCGTCGTTCTTGCTGTCAACACTCGGCAAACC
TCGTCAGCTCCAGATTTTACTGATTACCTGCACAGGATCC
TGAAGAACCACACTGCTCATGCCTGTGATGGAGAGACTCT
GTCCATCAGATGTCCCTCTAGAACATCAGTGACTGTGCTC
TCTGCGTTTTATGGCCGACGCGTCCCAAGTCCATATCTAT
GCCCATACACAAACCTAAACATGACAGAGGAGAACACTGA
CTGTGCATCAACCACAGCCATTCAGAAAGTGATGTCTGAA
TGCCAGGATCGACAGGAGTGTCACATTTCTGTCGTGAGTC
CAGTATTTGGTCAAGATCCCTGCCCTGAAGCCAGGAAATA
CATCATTGTCTCATACAAATGCAAGCCTGAACATCATCGC
TCGAGAACGGTGTGTGAGAACGAGAGGCTGAGGCTGACCT
GTAAGAACGACACAGTTCTGGCCATCTATTCAGCCACGTT
CGGCCATCTGGAGCACGACAGCCTCGAGTGCCCTCAAGAG
GCGAAAACAAAGACGGACATGGAGTGCTTGTCTCCGTCAG
CATTGAGGAGGGTCTCGAGAAAGTGTCATGGCCGGACCAA
CTGCTCTGTCATGGCTGATGCTCAGGGTTTTGGAGACCCC
TGTTTTCCTGGCACCAGAAAGCACCTGCGGGTGTCCTTTA
CATGTGTACCACGGTATCTCCTGGAAGATGTTGGACGTGG
AAACATAGATCCCTTCTTGCTCTCTGACTATACACATGGT
CTTCCAGAGACAGTTGCTCTATACTTTGTCTCGGGTATAT
GTGCTGGACTGTTCTTCTTGCTGTGTTTGTTCGGCCTCAA
ATCCACCCTGATACGAGATCTGAAAGACCTGGCCTCTGAG
CTGGGAGATGAGCTGAGGTCCTTTGACGACGATGCCTCCT
TGCGTTCTACATTTCCCCCCCTCACACGCCCTTATCGCAC
ACCGGACGTGTTCAATCCAGAGATGATAATGACAGTGGTG
ATGGAAGACAGGAGGGATGAGGACAAACCCGAGATGCCTA
ATGGAGACATCTGGCCCCATATCAACTCCAGTCCTTATGC
CATGCACAAAATCAAAACCACCTCTGCTTGATCTCGATGT
TCTACGTATGTTGTTGACCAAATACTAATTGTACTACTTA
AGAAGATTGAAATCCAAGATTGGAGTGTCTAGGTCTTATC
TGCTTATTTTTCCTCAATATACTATTCATGTATGCATTTT
CATATTTATGTATAATACAATCTGTGATTTATTAAATGAG
TTTGGATGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations