Transcript

si:dkey-22l11.6-002

ID
ZDB-TSCRIPT-110912-109
Name
si:dkey-22l11.6-002
Previous Names
  • dkey-22l11.6-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000051581 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000051581|OTTDARG00000009779|ZDB-GENE-041210-251 si:dkey-22l11.6|no_translation DKEY-22L11.6-002 LG_ BX248111.7 Danio rerio protein_coding NOVEL, 355 bp
ATGTTCCGTTGCCTCGGCGCCAAAGCCCAAAGGAAGGTTT
ACAGAATCCAGTCAGATTGAAGCAAGACACCACAGCCGGA
TTTCTGTACATCCATTTGCACAGTACTGTACAACAAGTTT
CCTTTGCTGAGTTCCTTGGTCAGGGGTTTAAACACATTTT
CTGTCCAGTACTGCAGTTGGAATTTTCCATCAACTTTTTA
TGGTAAGTAACTGCAAAACATTTATCACTACACATTACAG
TAAACAGTTTCTTAACTGAATATGTTGCTCTGAAAAATCT
AAATAGTCCCAAAAAAGGAAATTTACTCACTATTCACTCA
CCATGGTTTTAAACCTTTGAGTTTCTTTTATCTGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations